\
| Variant ID: vg1216877905 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16877905 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATGTGCATTCATGAACGCAATTTCGCAGAAGGTCATCGATCCGGATAGATTAGAAGCCCTTCAGAATGAAGTGGTGCAATGTCTCGTCAGTTTTGAGTTG[G/A]
TATTTCCACCTTCATTTTCAATATAATGACGCATCTGCTTTGTCACCTTGTGAAAGAGATCCGTATTCTCGGGCCTATGTACCTACACAACATGTTTCCT
AGGAAACATGTTGTGTAGGTACATAGGCCCGAGAATACGGATCTCTTTCACAAGGTGACAAAGCAGATGCGTCATTATATTGAAAATGAAGGTGGAAATA[C/T]
CAACTCAAAACTGACGAGACATTGCACCACTTCATTCTGAAGGGCTTCTAATCTATCCGGATCGATGACCTTCTGCGAAATTGCGTTCATGAATGCACAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 22.10% | 0.50% | 14.13% | 63.27% | NA |
| All Indica | 2759 | 9.70% | 0.30% | 19.17% | 70.82% | NA |
| All Japonica | 1512 | 48.10% | 0.90% | 6.08% | 44.91% | NA |
| Aus | 269 | 5.20% | 0.00% | 7.81% | 86.99% | NA |
| Indica I | 595 | 22.90% | 0.00% | 11.43% | 65.71% | NA |
| Indica II | 465 | 6.90% | 0.00% | 20.65% | 72.47% | NA |
| Indica III | 913 | 1.00% | 0.70% | 23.88% | 74.48% | NA |
| Indica Intermediate | 786 | 11.50% | 0.40% | 18.70% | 69.47% | NA |
| Temperate Japonica | 767 | 80.20% | 1.60% | 5.08% | 13.17% | NA |
| Tropical Japonica | 504 | 7.50% | 0.00% | 4.56% | 87.90% | NA |
| Japonica Intermediate | 241 | 31.10% | 0.40% | 12.45% | 56.02% | NA |
| VI/Aromatic | 96 | 2.10% | 0.00% | 17.71% | 80.21% | NA |
| Intermediate | 90 | 37.80% | 1.10% | 10.00% | 51.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216877905 | G -> DEL | LOC_Os12g28560.1 | N | splice_donor_variant | Average:8.988; most accessible tissue: Minghui63 root, score: 17.665 | N | N | N | N |
| vg1216877905 | G -> A | LOC_Os12g28560.1 | splice_donor_variant&intron_variant ; HIGH | splice_donor_variant | Average:8.988; most accessible tissue: Minghui63 root, score: 17.665 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216877905 | 9.40E-07 | NA | mr1142 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216877905 | NA | 1.91E-14 | mr1142 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216877905 | NA | 5.88E-08 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216877905 | NA | 5.35E-06 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216877905 | 1.25E-06 | NA | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216877905 | 3.61E-07 | NA | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216877905 | 7.53E-08 | NA | mr1778 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216877905 | NA | 1.77E-07 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216877905 | NA | 8.07E-07 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216877905 | NA | 2.66E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216877905 | NA | 7.40E-09 | mr1189_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216877905 | NA | 7.48E-06 | mr1268_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216877905 | NA | 2.94E-10 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |