\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216843502:

Variant ID: vg1216843502 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16843502
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTGCTCGAGGTCTTGTGGGTCTTGACCTTCGCCCGGATCCGCGGCTCCCTCGGTCTCTGTAGTTACGTGCGTAAGAACAATTTGAATTCGATTAGAAT[T/C]
CAAATAAAAATCCAAGTAAATCCAAATGGAAGTCGAATGCGAAAATCAATTCTCTTATATTATCTTTACTATTCGCGAATTAGGGCGAACCCCATTTTGA

Reverse complement sequence

TCAAAATGGGGTTCGCCCTAATTCGCGAATAGTAAAGATAATATAAGAGAATTGATTTTCGCATTCGACTTCCATTTGGATTTACTTGGATTTTTATTTG[A/G]
ATTCTAATCGAATTCAAATTGTTCTTACGCACGTAACTACAGAGACCGAGGGAGCCGCGGATCCGGGCGAAGGTCAAGACCCACAAGACCTCGAGCAAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.80% 1.50% 16.93% 50.76% NA
All Indica  2759 20.00% 1.90% 24.14% 53.93% NA
All Japonica  1512 54.60% 0.90% 4.83% 39.68% NA
Aus  269 12.30% 0.00% 11.90% 75.84% NA
Indica I  595 41.70% 0.00% 10.25% 48.07% NA
Indica II  465 22.80% 0.90% 12.69% 63.66% NA
Indica III  913 2.80% 4.60% 44.25% 48.30% NA
Indica Intermediate  786 21.90% 0.90% 18.07% 59.16% NA
Temperate Japonica  767 87.50% 0.00% 0.13% 12.39% NA
Tropical Japonica  504 13.30% 2.20% 12.90% 71.63% NA
Japonica Intermediate  241 36.10% 1.20% 2.90% 59.75% NA
VI/Aromatic  96 8.30% 5.20% 17.71% 68.75% NA
Intermediate  90 41.10% 0.00% 13.33% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216843502 T -> C LOC_Os12g28490.1 upstream_gene_variant ; 3099.0bp to feature; MODIFIER silent_mutation Average:17.104; most accessible tissue: Callus, score: 36.852 N N N N
vg1216843502 T -> C LOC_Os12g28500.1 downstream_gene_variant ; 155.0bp to feature; MODIFIER silent_mutation Average:17.104; most accessible tissue: Callus, score: 36.852 N N N N
vg1216843502 T -> C LOC_Os12g28500-LOC_Os12g28510 intergenic_region ; MODIFIER silent_mutation Average:17.104; most accessible tissue: Callus, score: 36.852 N N N N
vg1216843502 T -> DEL N N silent_mutation Average:17.104; most accessible tissue: Callus, score: 36.852 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216843502 NA 3.14E-12 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 3.11E-06 NA mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 4.01E-07 4.88E-11 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 1.25E-07 3.36E-10 mr1114 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 1.21E-08 4.67E-12 mr1116 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 6.63E-08 1.13E-19 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 1.58E-10 3.35E-22 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 NA 1.55E-08 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 7.31E-06 7.96E-08 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 NA 7.08E-12 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 NA 2.65E-09 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 1.42E-08 1.77E-11 mr1247 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 9.10E-07 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 6.68E-10 3.72E-24 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 NA 2.52E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 NA 1.44E-08 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 6.39E-08 1.96E-14 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 3.03E-06 2.05E-12 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 1.19E-06 1.14E-07 mr1917 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 6.24E-07 1.31E-12 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 7.96E-07 6.14E-13 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 7.75E-06 1.85E-09 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 NA 2.99E-18 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 1.32E-07 3.34E-21 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 NA 2.94E-09 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 3.55E-07 3.53E-13 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 NA 1.59E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 NA 3.59E-12 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 2.46E-06 9.79E-12 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 6.17E-06 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 8.01E-07 1.32E-08 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 6.80E-07 3.24E-22 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 6.28E-09 7.94E-24 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 NA 1.37E-06 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 NA 2.27E-14 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 NA 1.02E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843502 NA 2.53E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251