Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216843191:

Variant ID: vg1216843191 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16843191
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

ACCATTATCATGGCAATGTGGTGCTCATGCCTCCACATGCCGCATCTCAATTACCTTCCCAAAGGTAATTGCCCAAGCATATAGCATTTGATAAATATGA[A/T]
CATGCAAGATTCTAGAATAGCATTTTCTAAGCAAGTGTCATAATTGACTAGGGACTCATACGTAATTATGGTTACAAGGATTTGAAGGAAAACAATAACA

Reverse complement sequence

TGTTATTGTTTTCCTTCAAATCCTTGTAACCATAATTACGTATGAGTCCCTAGTCAATTATGACACTTGCTTAGAAAATGCTATTCTAGAATCTTGCATG[T/A]
TCATATTTATCAAATGCTATATGCTTGGGCAATTACCTTTGGGAAGGTAATTGAGATGCGGCATGTGGAGGCATGAGCACCACATTGCCATGATAATGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.40%	7.70%	21.79%	15.13%	NA
All Indica	2759	46.00%	9.90%	24.61%	19.50%	NA
All Japonica	1512	67.90%	4.60%	18.52%	9.06%	NA
Aus	269	94.10%	0.40%	4.83%	0.74%	NA
Indica I	595	88.70%	0.30%	6.05%	4.87%	NA
Indica II	465	37.40%	8.20%	22.80%	31.61%	NA
Indica III	913	19.40%	19.10%	38.88%	22.67%	NA
Indica Intermediate	786	49.70%	7.40%	23.16%	19.72%	NA
Temperate Japonica	767	88.70%	0.40%	3.39%	7.56%	NA
Tropical Japonica	504	42.10%	11.30%	42.06%	4.56%	NA
Japonica Intermediate	241	55.60%	3.70%	17.43%	23.24%	NA
VI/Aromatic	96	14.60%	17.70%	38.54%	29.17%	NA
Intermediate	90	61.10%	4.40%	23.33%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216843191	A -> DEL	N	N	silent_mutation	Average:22.46; most accessible tissue: Minghui63 young leaf, score: 35.334	N	N	N	N
vg1216843191	A -> T	LOC_Os12g28490.1	upstream_gene_variant ; 2788.0bp to feature; MODIFIER	silent_mutation	Average:22.46; most accessible tissue: Minghui63 young leaf, score: 35.334	N	N	N	N
vg1216843191	A -> T	LOC_Os12g28500.1	intron_variant ; MODIFIER	silent_mutation	Average:22.46; most accessible tissue: Minghui63 young leaf, score: 35.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216843191	3.96E-06	4.44E-13	mr1026	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	2.65E-06	NA	mr1110	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	1.51E-07	1.29E-11	mr1113	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	2.36E-07	9.74E-11	mr1114	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	1.60E-08	1.74E-12	mr1116	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	7.71E-10	1.85E-21	mr1118	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	8.72E-11	1.51E-22	mr1118	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	NA	1.03E-08	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	9.95E-06	9.52E-08	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	NA	6.27E-06	mr1123	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	9.32E-06	1.22E-12	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	NA	1.34E-09	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	1.37E-07	6.43E-11	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	2.15E-09	7.37E-24	mr1495	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	3.78E-11	1.13E-25	mr1495	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	NA	2.74E-07	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	NA	6.45E-09	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	5.58E-10	1.45E-15	mr1794	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	1.42E-06	3.89E-13	mr1794	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	NA	4.71E-07	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	NA	3.06E-06	mr1936	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	1.40E-08	4.96E-14	mr1113_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	1.20E-08	1.93E-14	mr1114_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	3.77E-07	7.18E-11	mr1117_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	4.26E-07	1.55E-20	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	8.83E-08	3.92E-21	mr1118_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	8.12E-07	1.45E-10	mr1119_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	2.56E-08	2.67E-14	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	1.30E-06	1.07E-12	mr1161_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	NA	1.27E-07	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	7.09E-08	4.60E-13	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	4.78E-08	NA	mr1258_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	1.28E-07	2.76E-09	mr1258_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	4.57E-09	7.37E-26	mr1495_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	1.72E-09	7.50E-25	mr1495_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	NA	3.94E-09	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	NA	1.29E-06	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	NA	2.06E-15	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	NA	1.22E-06	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	NA	1.84E-06	mr1836_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	NA	3.37E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191	NA	5.55E-06	mr1961_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251