\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216843191:

Variant ID: vg1216843191 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16843191
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


ACCATTATCATGGCAATGTGGTGCTCATGCCTCCACATGCCGCATCTCAATTACCTTCCCAAAGGTAATTGCCCAAGCATATAGCATTTGATAAATATGA[A/T]
CATGCAAGATTCTAGAATAGCATTTTCTAAGCAAGTGTCATAATTGACTAGGGACTCATACGTAATTATGGTTACAAGGATTTGAAGGAAAACAATAACA

Reverse complement sequence

TGTTATTGTTTTCCTTCAAATCCTTGTAACCATAATTACGTATGAGTCCCTAGTCAATTATGACACTTGCTTAGAAAATGCTATTCTAGAATCTTGCATG[T/A]
TCATATTTATCAAATGCTATATGCTTGGGCAATTACCTTTGGGAAGGTAATTGAGATGCGGCATGTGGAGGCATGAGCACCACATTGCCATGATAATGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.40% 7.70% 21.79% 15.13% NA
All Indica  2759 46.00% 9.90% 24.61% 19.50% NA
All Japonica  1512 67.90% 4.60% 18.52% 9.06% NA
Aus  269 94.10% 0.40% 4.83% 0.74% NA
Indica I  595 88.70% 0.30% 6.05% 4.87% NA
Indica II  465 37.40% 8.20% 22.80% 31.61% NA
Indica III  913 19.40% 19.10% 38.88% 22.67% NA
Indica Intermediate  786 49.70% 7.40% 23.16% 19.72% NA
Temperate Japonica  767 88.70% 0.40% 3.39% 7.56% NA
Tropical Japonica  504 42.10% 11.30% 42.06% 4.56% NA
Japonica Intermediate  241 55.60% 3.70% 17.43% 23.24% NA
VI/Aromatic  96 14.60% 17.70% 38.54% 29.17% NA
Intermediate  90 61.10% 4.40% 23.33% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216843191 A -> DEL N N silent_mutation Average:22.46; most accessible tissue: Minghui63 young leaf, score: 35.334 N N N N
vg1216843191 A -> T LOC_Os12g28490.1 upstream_gene_variant ; 2788.0bp to feature; MODIFIER silent_mutation Average:22.46; most accessible tissue: Minghui63 young leaf, score: 35.334 N N N N
vg1216843191 A -> T LOC_Os12g28500.1 intron_variant ; MODIFIER silent_mutation Average:22.46; most accessible tissue: Minghui63 young leaf, score: 35.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216843191 3.96E-06 4.44E-13 mr1026 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 2.65E-06 NA mr1110 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 1.51E-07 1.29E-11 mr1113 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 2.36E-07 9.74E-11 mr1114 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 1.60E-08 1.74E-12 mr1116 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 7.71E-10 1.85E-21 mr1118 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 8.72E-11 1.51E-22 mr1118 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 NA 1.03E-08 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 9.95E-06 9.52E-08 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 NA 6.27E-06 mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 9.32E-06 1.22E-12 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 NA 1.34E-09 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 1.37E-07 6.43E-11 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 2.15E-09 7.37E-24 mr1495 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 3.78E-11 1.13E-25 mr1495 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 NA 2.74E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 NA 6.45E-09 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 5.58E-10 1.45E-15 mr1794 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 1.42E-06 3.89E-13 mr1794 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 NA 4.71E-07 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 NA 3.06E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 1.40E-08 4.96E-14 mr1113_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 1.20E-08 1.93E-14 mr1114_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 3.77E-07 7.18E-11 mr1117_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 4.26E-07 1.55E-20 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 8.83E-08 3.92E-21 mr1118_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 8.12E-07 1.45E-10 mr1119_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 2.56E-08 2.67E-14 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 1.30E-06 1.07E-12 mr1161_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 NA 1.27E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 7.09E-08 4.60E-13 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 4.78E-08 NA mr1258_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 1.28E-07 2.76E-09 mr1258_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 4.57E-09 7.37E-26 mr1495_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 1.72E-09 7.50E-25 mr1495_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 NA 3.94E-09 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 NA 1.29E-06 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 NA 2.06E-15 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 NA 1.22E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 NA 1.84E-06 mr1836_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 NA 3.37E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216843191 NA 5.55E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251