| Variant ID: vg1216759715 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16759715 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTCTCCTCCGTTACATCGGAGGGCGCCCACTGACTCTCAAAGCTCTCTCTCTCTCTCTCTTCCGCCATGGATGCGATCTGGATGATATGATTTGGTTCGG[A/G]
GTATGGCTAGGAATGAATGGGAGATTGATGCTGTGGTTGTGTGGAAGATTTTCGTGGAGTTTTGGAGGATGGATTGGGGTGAATCGGTGAACCCTAGTTT
AAACTAGGGTTCACCGATTCACCCCAATCCATCCTCCAAAACTCCACGAAAATCTTCCACACAACCACAGCATCAATCTCCCATTCATTCCTAGCCATAC[T/C]
CCGAACCAAATCATATCATCCAGATCGCATCCATGGCGGAAGAGAGAGAGAGAGAGAGCTTTGAGAGTCAGTGGGCGCCCTCCGATGTAACGGAGGAGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.20% | 7.70% | 1.02% | 51.12% | NA |
| All Indica | 2759 | 22.90% | 0.50% | 1.20% | 75.39% | NA |
| All Japonica | 1512 | 75.90% | 17.30% | 0.33% | 6.42% | NA |
| Aus | 269 | 23.40% | 0.00% | 1.12% | 75.46% | NA |
| Indica I | 595 | 48.40% | 0.00% | 1.51% | 50.08% | NA |
| Indica II | 465 | 25.20% | 0.20% | 2.80% | 71.83% | NA |
| Indica III | 913 | 2.30% | 0.30% | 0.66% | 96.71% | NA |
| Indica Intermediate | 786 | 26.30% | 1.10% | 0.64% | 71.88% | NA |
| Temperate Japonica | 767 | 96.20% | 0.30% | 0.00% | 3.52% | NA |
| Tropical Japonica | 504 | 42.50% | 46.60% | 0.79% | 10.12% | NA |
| Japonica Intermediate | 241 | 81.30% | 10.40% | 0.41% | 7.88% | NA |
| VI/Aromatic | 96 | 9.40% | 75.00% | 5.21% | 10.42% | NA |
| Intermediate | 90 | 51.10% | 17.80% | 2.22% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216759715 | A -> DEL | N | N | silent_mutation | Average:10.201; most accessible tissue: Callus, score: 38.134 | N | N | N | N |
| vg1216759715 | A -> G | LOC_Os12g28340.1 | upstream_gene_variant ; 33.0bp to feature; MODIFIER | silent_mutation | Average:10.201; most accessible tissue: Callus, score: 38.134 | N | N | N | N |
| vg1216759715 | A -> G | LOC_Os12g28330.1 | downstream_gene_variant ; 3320.0bp to feature; MODIFIER | silent_mutation | Average:10.201; most accessible tissue: Callus, score: 38.134 | N | N | N | N |
| vg1216759715 | A -> G | LOC_Os12g28340-LOC_Os12g28350 | intergenic_region ; MODIFIER | silent_mutation | Average:10.201; most accessible tissue: Callus, score: 38.134 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216759715 | 9.43E-06 | NA | mr1296 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216759715 | NA | 2.58E-11 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216759715 | NA | 1.46E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216759715 | NA | 6.54E-07 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216759715 | NA | 1.77E-11 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216759715 | NA | 9.20E-07 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |