\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216759594:

Variant ID: vg1216759594 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16759594
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAATAAGAAAATACCATGACCTCGTGTGTGTCCGGGGTCGGAAATGCTTCACCGCATGCTGGACGCCACCCAATGATCTCCTTTGCTGGAAGAACGCCG[C/T]
GCGCCACCATCTCCTTCAGGTTCTCCTCCGTTACATCGGAGGGCGCCCACTGACTCTCAAAGCTCTCTCTCTCTCTCTCTTCCGCCATGGATGCGATCTG

Reverse complement sequence

CAGATCGCATCCATGGCGGAAGAGAGAGAGAGAGAGAGCTTTGAGAGTCAGTGGGCGCCCTCCGATGTAACGGAGGAGAACCTGAAGGAGATGGTGGCGC[G/A]
CGGCGTTCTTCCAGCAAAGGAGATCATTGGGTGGCGTCCAGCATGCGGTGAAGCATTTCCGACCCCGGACACACACGAGGTCATGGTATTTTCTTATTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.10% 7.70% 0.85% 51.40% NA
All Indica  2759 22.70% 0.40% 1.12% 75.75% NA
All Japonica  1512 76.10% 17.30% 0.26% 6.42% NA
Aus  269 22.70% 0.00% 0.74% 76.58% NA
Indica I  595 47.90% 0.00% 1.34% 50.76% NA
Indica II  465 26.20% 0.40% 1.29% 72.04% NA
Indica III  913 2.10% 0.40% 0.55% 96.93% NA
Indica Intermediate  786 25.60% 0.60% 1.53% 72.26% NA
Temperate Japonica  767 96.20% 0.30% 0.00% 3.52% NA
Tropical Japonica  504 43.10% 46.40% 0.40% 10.12% NA
Japonica Intermediate  241 80.90% 10.40% 0.83% 7.88% NA
VI/Aromatic  96 9.40% 79.20% 1.04% 10.42% NA
Intermediate  90 51.10% 17.80% 2.22% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216759594 C -> DEL LOC_Os12g28340.1 N frameshift_variant Average:7.516; most accessible tissue: Callus, score: 18.568 N N N N
vg1216759594 C -> T LOC_Os12g28340.1 missense_variant ; p.Arg30His; MODERATE nonsynonymous_codon ; R30H Average:7.516; most accessible tissue: Callus, score: 18.568 possibly damaging -1.538 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216759594 NA 6.83E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216759594 NA 2.76E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216759594 NA 7.68E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216759594 NA 7.46E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216759594 NA 9.55E-07 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216759594 NA 6.78E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216759594 NA 8.79E-06 mr1266_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216759594 NA 7.05E-06 mr1306_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216759594 NA 2.98E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216759594 NA 2.62E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216759594 NA 2.73E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216759594 9.19E-06 9.19E-06 mr1523_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216759594 3.82E-07 3.82E-07 mr1529_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216759594 NA 8.58E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216759594 NA 1.28E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216759594 NA 7.99E-06 mr1849_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216759594 NA 9.91E-07 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251