| Variant ID: vg1216757238 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16757238 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 51. )
AAGCCTCTTAATTTTGTTGACCAAGACATCGAATTGAGCCTGAGATTTGATCTTGCGATCTACATAAATAGATTTATATCAACGAGTGGGCATAAAGAAA[A/G]
GAATGGTTTTTAAAGTATTAGTTACCAGTACCTTCAACATCTTTCAGAGCCAAATCCCTTTGTCTTGCCAATTCGGCCTTGTCTTTCTCCAGAGCTTGGA
TCCAAGCTCTGGAGAAAGACAAGGCCGAATTGGCAAGACAAAGGGATTTGGCTCTGAAAGATGTTGAAGGTACTGGTAACTAATACTTTAAAAACCATTC[T/C]
TTTCTTTATGCCCACTCGTTGATATAAATCTATTTATGTAGATCGCAAGATCAAATCTCAGGCTCAATTCGATGTCTTGGTCAACAAAATTAAGAGGCTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.50% | 29.30% | 7.38% | 24.76% | NA |
| All Indica | 2759 | 22.50% | 28.10% | 10.58% | 38.75% | NA |
| All Japonica | 1512 | 71.80% | 21.10% | 2.91% | 4.17% | NA |
| Aus | 269 | 21.90% | 65.40% | 2.60% | 10.04% | NA |
| Indica I | 595 | 46.70% | 24.90% | 8.07% | 20.34% | NA |
| Indica II | 465 | 25.20% | 25.80% | 12.47% | 36.56% | NA |
| Indica III | 913 | 2.80% | 28.80% | 11.83% | 56.52% | NA |
| Indica Intermediate | 786 | 25.60% | 31.20% | 9.92% | 33.33% | NA |
| Temperate Japonica | 767 | 95.80% | 2.30% | 0.91% | 0.91% | NA |
| Tropical Japonica | 504 | 35.30% | 52.00% | 5.16% | 7.54% | NA |
| Japonica Intermediate | 241 | 71.80% | 16.20% | 4.56% | 7.47% | NA |
| VI/Aromatic | 96 | 8.30% | 86.50% | 2.08% | 3.12% | NA |
| Intermediate | 90 | 50.00% | 36.70% | 4.44% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216757238 | A -> DEL | N | N | silent_mutation | Average:8.679; most accessible tissue: Callus, score: 37.708 | N | N | N | N |
| vg1216757238 | A -> G | LOC_Os12g28330.1 | downstream_gene_variant ; 843.0bp to feature; MODIFIER | silent_mutation | Average:8.679; most accessible tissue: Callus, score: 37.708 | N | N | N | N |
| vg1216757238 | A -> G | LOC_Os12g28340.1 | intron_variant ; MODIFIER | silent_mutation | Average:8.679; most accessible tissue: Callus, score: 37.708 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216757238 | NA | 1.41E-09 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216757238 | NA | 3.66E-10 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216757238 | NA | 1.24E-08 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216757238 | NA | 1.37E-11 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216757238 | NA | 1.87E-11 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216757238 | NA | 5.70E-12 | mr1235 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216757238 | NA | 2.91E-07 | mr1243 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216757238 | NA | 2.49E-12 | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216757238 | NA | 1.89E-12 | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216757238 | NA | 1.80E-10 | mr1539 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/