\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216729378:

Variant ID: vg1216729378 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16729378
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


GTGAGAAGTTTCTTGAAGTCTTCAAAGGCTTTCTGTGCTTCGGGTCCCCACTGGAAATTGTCTGTTTTCTTTAACAGCTTGAAGAAGGGCATCCCCCGCT[C/T]
GCCAAGTCGTGAAACGAACCGGCTGAGCGCCGCCATGCAACCAGTCAACTTTTGGACATCTTTCTGAGAACTTGGCGGTTTCATGTTGAGGATGGCATTG

Reverse complement sequence

CAATGCCATCCTCAACATGAAACCGCCAAGTTCTCAGAAAGATGTCCAAAAGTTGACTGGTTGCATGGCGGCGCTCAGCCGGTTCGTTTCACGACTTGGC[G/A]
AGCGGGGGATGCCCTTCTTCAAGCTGTTAAAGAAAACAGACAATTTCCAGTGGGGACCCGAAGCACAGAAAGCCTTTGAAGACTTCAAGAAACTTCTCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 35.60% 10.33% 4.76% NA
All Indica  2759 33.70% 54.40% 11.05% 0.87% NA
All Japonica  1512 76.20% 1.90% 8.86% 13.10% NA
Aus  269 37.50% 51.30% 11.15% 0.00% NA
Indica I  595 17.50% 68.90% 13.61% 0.00% NA
Indica II  465 29.50% 49.90% 16.77% 3.87% NA
Indica III  913 47.80% 47.00% 5.26% 0.00% NA
Indica Intermediate  786 32.10% 54.70% 12.47% 0.76% NA
Temperate Japonica  767 94.90% 2.20% 2.74% 0.13% NA
Tropical Japonica  504 41.50% 1.80% 18.25% 38.49% NA
Japonica Intermediate  241 89.20% 0.80% 8.71% 1.24% NA
VI/Aromatic  96 87.50% 4.20% 8.33% 0.00% NA
Intermediate  90 70.00% 14.40% 12.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216729378 C -> DEL LOC_Os12g28290.1 N frameshift_variant Average:13.546; most accessible tissue: Zhenshan97 flower, score: 26.922 N N N N
vg1216729378 C -> T LOC_Os12g28290.1 missense_variant ; p.Glu960Lys; MODERATE nonsynonymous_codon ; E960K Average:13.546; most accessible tissue: Zhenshan97 flower, score: 26.922 benign 1.166 DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216729378 NA 8.34E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729378 NA 5.03E-06 mr1772 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729378 NA 5.72E-09 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729378 2.21E-06 4.36E-08 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729378 NA 5.90E-06 mr1248_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729378 1.12E-07 NA mr1255_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729378 2.42E-06 3.29E-06 mr1255_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729378 NA 6.73E-08 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729378 NA 5.30E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729378 NA 1.82E-06 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729378 NA 1.36E-09 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729378 NA 1.45E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729378 NA 3.43E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729378 1.88E-06 9.08E-09 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729378 NA 2.37E-06 mr1912_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729378 NA 4.57E-10 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729378 2.76E-06 NA mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729378 NA 3.72E-10 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251