\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216729091:

Variant ID: vg1216729091 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16729091
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCCGAGTGGAAACGATGTAACCACCGTGACCGAGTGACCTTGGAAGTAGTGAGATAATTTCCTGACGGTAATTAGAACACCATATAATTGCTTCTGGAC[C/T]
TGAGGATATCTCGTCTTGGAGTCGGCCAAAACCTCGCTAACGAAGTAGATTGGTCGCTGAACTTTCTGAACATGGCCTTCTTCTTCACGCTCAACAACCA

Reverse complement sequence

TGGTTGTTGAGCGTGAAGAAGAAGGCCATGTTCAGAAAGTTCAGCGACCAATCTACTTCGTTAGCGAGGTTTTGGCCGACTCCAAGACGAGATATCCTCA[G/A]
GTCCAGAAGCAATTATATGGTGTTCTAATTACCGTCAGGAAATTATCTCACTACTTCCAAGGTCACTCGGTCACGGTGGTTACATCGTTTCCACTCGGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.50% 0.10% 49.05% 11.28% NA
All Indica  2759 19.20% 0.10% 70.24% 10.44% NA
All Japonica  1512 75.70% 0.10% 9.06% 15.21% NA
Aus  269 51.70% 0.00% 46.10% 2.23% NA
Indica I  595 9.70% 0.00% 66.05% 24.20% NA
Indica II  465 21.50% 0.20% 67.10% 11.18% NA
Indica III  913 21.50% 0.00% 77.00% 1.53% NA
Indica Intermediate  786 22.50% 0.10% 67.43% 9.92% NA
Temperate Japonica  767 94.50% 0.00% 3.65% 1.83% NA
Tropical Japonica  504 44.00% 0.20% 16.27% 39.48% NA
Japonica Intermediate  241 81.70% 0.00% 11.20% 7.05% NA
VI/Aromatic  96 10.40% 3.10% 82.29% 4.17% NA
Intermediate  90 48.90% 1.10% 44.44% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216729091 C -> DEL LOC_Os12g28290.1 N frameshift_variant Average:8.373; most accessible tissue: Zhenshan97 flower, score: 18.233 N N N N
vg1216729091 C -> T LOC_Os12g28290.1 synonymous_variant ; p.Gln1055Gln; LOW synonymous_codon Average:8.373; most accessible tissue: Zhenshan97 flower, score: 18.233 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216729091 NA 3.50E-45 mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 NA 1.08E-35 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 NA 1.10E-29 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 NA 1.19E-34 mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 NA 3.11E-62 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 NA 3.88E-08 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 NA 3.72E-06 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 NA 5.14E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 NA 1.62E-40 mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 NA 3.98E-71 mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 NA 6.45E-49 mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 NA 8.00E-55 mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 NA 4.42E-21 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 NA 1.17E-33 mr1368_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 NA 4.86E-23 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 NA 1.27E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 NA 4.38E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 NA 2.27E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 NA 4.19E-13 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729091 3.35E-06 7.81E-09 mr1987_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251