\
| Variant ID: vg1216728974 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16728974 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGTCGGCTAAAGCTTGGGACTTGATCGAAGTTCCCGGCTTGAACGATATATCCAAGGACATCAGTTCTAAGGCCCATTTTGTGATCCGCCCATTGGCTTC[G/A]
CGATTATGAAGTATATCCCCGAGTGGAAACGATGTAACCACCGTGACCGAGTGACCTTGGAAGTAGTGAGATAATTTCCTGACGGTAATTAGAACACCAT
ATGGTGTTCTAATTACCGTCAGGAAATTATCTCACTACTTCCAAGGTCACTCGGTCACGGTGGTTACATCGTTTCCACTCGGGGATATACTTCATAATCG[C/T]
GAAGCCAATGGGCGGATCACAAAATGGGCCTTAGAACTGATGTCCTTGGATATATCGTTCAAGCCGGGAACTTCGATCAAGTCCCAAGCTTTAGCCGACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.50% | 7.40% | 2.60% | 4.42% | NA |
| All Indica | 2759 | 87.60% | 10.10% | 1.56% | 0.65% | NA |
| All Japonica | 1512 | 82.70% | 0.30% | 4.56% | 12.43% | NA |
| Aus | 269 | 72.90% | 24.50% | 2.60% | 0.00% | NA |
| Indica I | 595 | 91.80% | 7.10% | 1.18% | 0.00% | NA |
| Indica II | 465 | 78.50% | 15.90% | 2.80% | 2.80% | NA |
| Indica III | 913 | 90.40% | 8.50% | 1.10% | 0.00% | NA |
| Indica Intermediate | 786 | 86.80% | 10.90% | 1.65% | 0.64% | NA |
| Temperate Japonica | 767 | 98.70% | 0.00% | 1.04% | 0.26% | NA |
| Tropical Japonica | 504 | 52.80% | 0.40% | 10.32% | 36.51% | NA |
| Japonica Intermediate | 241 | 94.60% | 0.80% | 3.73% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 2.20% | 4.44% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216728974 | G -> DEL | LOC_Os12g28290.1 | N | frameshift_variant | Average:11.457; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1216728974 | G -> A | LOC_Os12g28290.1 | synonymous_variant ; p.Arg1094Arg; LOW | synonymous_codon | Average:11.457; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216728974 | NA | 2.86E-09 | mr1317 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728974 | NA | 8.70E-11 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728974 | NA | 7.02E-06 | mr1350 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728974 | NA | 2.18E-06 | mr1818 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728974 | 4.61E-07 | 1.31E-26 | mr1855 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728974 | 4.98E-07 | 2.53E-21 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728974 | NA | 1.56E-06 | mr1914 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728974 | NA | 4.62E-13 | mr1317_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728974 | NA | 3.91E-14 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728974 | NA | 5.74E-10 | mr1610_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728974 | NA | 2.01E-10 | mr1818_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728974 | NA | 2.64E-10 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728974 | NA | 1.32E-24 | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728974 | NA | 6.10E-19 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728974 | NA | 4.99E-13 | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728974 | 4.20E-06 | 1.06E-12 | mr1897_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728974 | NA | 3.46E-12 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728974 | NA | 1.85E-12 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |