\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216728961:

Variant ID: vg1216728961 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16728961
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACTCGGCGACGAAGTCGGCTAAAGCTTGGGACTTGATCGAAGTTCCCGGCTTGAACGATATATCCAAGGACATCAGTTCTAAGGCCCATTTTGTGATCC[G/A]
CCCATTGGCTTCGCGATTATGAAGTATATCCCCGAGTGGAAACGATGTAACCACCGTGACCGAGTGACCTTGGAAGTAGTGAGATAATTTCCTGACGGTA

Reverse complement sequence

TACCGTCAGGAAATTATCTCACTACTTCCAAGGTCACTCGGTCACGGTGGTTACATCGTTTCCACTCGGGGATATACTTCATAATCGCGAAGCCAATGGG[C/T]
GGATCACAAAATGGGCCTTAGAACTGATGTCCTTGGATATATCGTTCAAGCCGGGAACTTCGATCAAGTCCCAAGCTTTAGCCGACTTCGTCGCCGAGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.00% 7.80% 2.01% 5.18% NA
All Indica  2759 87.20% 10.70% 1.45% 0.72% NA
All Japonica  1512 82.00% 0.50% 2.98% 14.55% NA
Aus  269 72.90% 24.90% 2.23% 0.00% NA
Indica I  595 91.30% 7.40% 1.34% 0.00% NA
Indica II  465 77.80% 16.80% 2.37% 3.01% NA
Indica III  913 89.80% 9.20% 0.99% 0.00% NA
Indica Intermediate  786 86.50% 11.20% 1.53% 0.76% NA
Temperate Japonica  767 98.70% 0.00% 0.00% 1.30% NA
Tropical Japonica  504 50.60% 0.80% 8.53% 40.08% NA
Japonica Intermediate  241 94.60% 1.20% 0.83% 3.32% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 88.90% 2.20% 3.33% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216728961 G -> DEL LOC_Os12g28290.1 N frameshift_variant Average:11.293; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1216728961 G -> A LOC_Os12g28290.1 missense_variant ; p.Arg1099Trp; MODERATE nonsynonymous_codon ; R1099W Average:11.293; most accessible tissue: Minghui63 panicle, score: 25.313 unknown unknown DELETERIOUS 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216728961 NA 4.28E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 1.02E-06 mr1253 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 6.49E-06 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 2.43E-11 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 7.37E-07 mr1350 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 2.44E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 4.16E-06 5.26E-26 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 6.46E-06 8.61E-23 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 4.88E-06 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 7.73E-11 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 3.83E-08 mr1248_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 5.81E-09 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 1.98E-07 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 1.00E-08 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 7.64E-10 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 1.90E-13 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 6.94E-17 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 4.83E-09 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 3.82E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 1.20E-06 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 8.73E-09 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 2.85E-13 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 1.38E-14 mr1818_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 5.04E-08 2.80E-28 mr1855_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 3.64E-09 1.58E-25 mr1855_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 8.57E-06 5.13E-14 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 1.29E-06 1.26E-15 mr1897_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 5.66E-06 8.98E-13 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 1.29E-06 7.76E-18 mr1914_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961 NA 2.14E-13 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251