| Variant ID: vg1216728961 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16728961 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CACTCGGCGACGAAGTCGGCTAAAGCTTGGGACTTGATCGAAGTTCCCGGCTTGAACGATATATCCAAGGACATCAGTTCTAAGGCCCATTTTGTGATCC[G/A]
CCCATTGGCTTCGCGATTATGAAGTATATCCCCGAGTGGAAACGATGTAACCACCGTGACCGAGTGACCTTGGAAGTAGTGAGATAATTTCCTGACGGTA
TACCGTCAGGAAATTATCTCACTACTTCCAAGGTCACTCGGTCACGGTGGTTACATCGTTTCCACTCGGGGATATACTTCATAATCGCGAAGCCAATGGG[C/T]
GGATCACAAAATGGGCCTTAGAACTGATGTCCTTGGATATATCGTTCAAGCCGGGAACTTCGATCAAGTCCCAAGCTTTAGCCGACTTCGTCGCCGAGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.00% | 7.80% | 2.01% | 5.18% | NA |
| All Indica | 2759 | 87.20% | 10.70% | 1.45% | 0.72% | NA |
| All Japonica | 1512 | 82.00% | 0.50% | 2.98% | 14.55% | NA |
| Aus | 269 | 72.90% | 24.90% | 2.23% | 0.00% | NA |
| Indica I | 595 | 91.30% | 7.40% | 1.34% | 0.00% | NA |
| Indica II | 465 | 77.80% | 16.80% | 2.37% | 3.01% | NA |
| Indica III | 913 | 89.80% | 9.20% | 0.99% | 0.00% | NA |
| Indica Intermediate | 786 | 86.50% | 11.20% | 1.53% | 0.76% | NA |
| Temperate Japonica | 767 | 98.70% | 0.00% | 0.00% | 1.30% | NA |
| Tropical Japonica | 504 | 50.60% | 0.80% | 8.53% | 40.08% | NA |
| Japonica Intermediate | 241 | 94.60% | 1.20% | 0.83% | 3.32% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 2.20% | 3.33% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216728961 | G -> DEL | LOC_Os12g28290.1 | N | frameshift_variant | Average:11.293; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1216728961 | G -> A | LOC_Os12g28290.1 | missense_variant ; p.Arg1099Trp; MODERATE | nonsynonymous_codon ; R1099W | Average:11.293; most accessible tissue: Minghui63 panicle, score: 25.313 | unknown | unknown | DELETERIOUS | 0.05 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216728961 | NA | 4.28E-06 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728961 | NA | 1.02E-06 | mr1253 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728961 | NA | 6.49E-06 | mr1308 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728961 | NA | 2.43E-11 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728961 | NA | 7.37E-07 | mr1350 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728961 | NA | 2.44E-06 | mr1818 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728961 | 4.16E-06 | 5.26E-26 | mr1855 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728961 | 6.46E-06 | 8.61E-23 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728961 | NA | 4.88E-06 | mr1914 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216728961 | NA | 7.73E-11 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/