Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216728961:

Variant ID: vg1216728961 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16728961
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACTCGGCGACGAAGTCGGCTAAAGCTTGGGACTTGATCGAAGTTCCCGGCTTGAACGATATATCCAAGGACATCAGTTCTAAGGCCCATTTTGTGATCC[G/A]
CCCATTGGCTTCGCGATTATGAAGTATATCCCCGAGTGGAAACGATGTAACCACCGTGACCGAGTGACCTTGGAAGTAGTGAGATAATTTCCTGACGGTA

Reverse complement sequence

TACCGTCAGGAAATTATCTCACTACTTCCAAGGTCACTCGGTCACGGTGGTTACATCGTTTCCACTCGGGGATATACTTCATAATCGCGAAGCCAATGGG[C/T]
GGATCACAAAATGGGCCTTAGAACTGATGTCCTTGGATATATCGTTCAAGCCGGGAACTTCGATCAAGTCCCAAGCTTTAGCCGACTTCGTCGCCGAGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.00%	7.80%	2.01%	5.18%	NA
All Indica	2759	87.20%	10.70%	1.45%	0.72%	NA
All Japonica	1512	82.00%	0.50%	2.98%	14.55%	NA
Aus	269	72.90%	24.90%	2.23%	0.00%	NA
Indica I	595	91.30%	7.40%	1.34%	0.00%	NA
Indica II	465	77.80%	16.80%	2.37%	3.01%	NA
Indica III	913	89.80%	9.20%	0.99%	0.00%	NA
Indica Intermediate	786	86.50%	11.20%	1.53%	0.76%	NA
Temperate Japonica	767	98.70%	0.00%	0.00%	1.30%	NA
Tropical Japonica	504	50.60%	0.80%	8.53%	40.08%	NA
Japonica Intermediate	241	94.60%	1.20%	0.83%	3.32%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	88.90%	2.20%	3.33%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216728961	G -> DEL	LOC_Os12g28290.1	N	frameshift_variant	Average:11.293; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg1216728961	G -> A	LOC_Os12g28290.1	missense_variant ; p.Arg1099Trp; MODERATE	nonsynonymous_codon ; R1099W	Average:11.293; most accessible tissue: Minghui63 panicle, score: 25.313	unknown	unknown	DELETERIOUS	0.05

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216728961	NA	4.28E-06	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	1.02E-06	mr1253	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	6.49E-06	mr1308	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	2.43E-11	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	7.37E-07	mr1350	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	2.44E-06	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	4.16E-06	5.26E-26	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	6.46E-06	8.61E-23	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	4.88E-06	mr1914	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	7.73E-11	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	3.83E-08	mr1248_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	5.81E-09	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	1.98E-07	mr1253_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	1.00E-08	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	7.64E-10	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	1.90E-13	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	6.94E-17	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	4.83E-09	mr1435_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	3.82E-06	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	1.20E-06	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	8.73E-09	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	2.85E-13	mr1818_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	1.38E-14	mr1818_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	5.04E-08	2.80E-28	mr1855_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	3.64E-09	1.58E-25	mr1855_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	8.57E-06	5.13E-14	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	1.29E-06	1.26E-15	mr1897_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	5.66E-06	8.98E-13	mr1914_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	1.29E-06	7.76E-18	mr1914_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728961	NA	2.14E-13	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251