\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216728800:

Variant ID: vg1216728800 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16728800
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGATGCAGAAAAATGTATCCATAACACGTAGCTCAGTCTTTCTCCAGTCGGGGAAATCAAAACAACCCCAGCCCCAGTGCCTGAAAGTCTCTTGGACCC[G/A]
TCAAAGTGCATAGTCCAATACTCCATCTTCTCCTCGGGCATATCTTCTTGGTGCTCGGTCCACTCGGCGACGAAGTCGGCTAAAGCTTGGGACTTGATCG

Reverse complement sequence

CGATCAAGTCCCAAGCTTTAGCCGACTTCGTCGCCGAGTGGACCGAGCACCAAGAAGATATGCCCGAGGAGAAGATGGAGTATTGGACTATGCACTTTGA[C/T]
GGGTCCAAGAGACTTTCAGGCACTGGGGCTGGGGTTGTTTTGATTTCCCCGACTGGAGAAAGACTGAGCTACGTGTTATGGATACATTTTTCTGCATCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 2.60% 5.46% 10.77% NA
All Indica  2759 82.10% 3.70% 5.84% 8.37% NA
All Japonica  1512 80.00% 0.40% 3.17% 16.47% NA
Aus  269 74.30% 5.20% 16.73% 3.72% NA
Indica I  595 81.00% 3.00% 4.54% 11.43% NA
Indica II  465 75.90% 6.70% 9.25% 8.17% NA
Indica III  913 86.30% 3.10% 4.60% 6.02% NA
Indica Intermediate  786 81.60% 3.30% 6.23% 8.91% NA
Temperate Japonica  767 94.90% 0.00% 3.13% 1.96% NA
Tropical Japonica  504 53.60% 1.00% 2.98% 42.46% NA
Japonica Intermediate  241 87.60% 0.40% 3.73% 8.30% NA
VI/Aromatic  96 89.60% 0.00% 0.00% 10.42% NA
Intermediate  90 85.60% 0.00% 4.44% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216728800 G -> DEL LOC_Os12g28290.1 N frameshift_variant Average:12.885; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1216728800 G -> A LOC_Os12g28290.1 synonymous_variant ; p.Asp1152Asp; LOW synonymous_codon Average:12.885; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216728800 3.47E-07 2.53E-14 mr1317 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 1.23E-06 2.64E-14 mr1317 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 9.52E-06 2.29E-07 mr1350 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 2.63E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 1.89E-07 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 1.04E-09 4.84E-31 mr1855 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 1.37E-11 2.07E-26 mr1855 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 1.64E-07 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 5.85E-06 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 6.37E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 6.62E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 2.34E-07 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 7.77E-06 7.61E-17 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 3.04E-16 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 6.71E-08 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 4.89E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 2.80E-09 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 3.90E-15 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 5.33E-13 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 1.44E-27 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 1.47E-21 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 1.24E-06 7.40E-17 mr1897_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 5.92E-14 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 1.75E-13 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 2.12E-14 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728800 NA 7.39E-14 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251