\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216728475:

Variant ID: vg1216728475 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16728475
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTTTCCTTGGTACGGTTGGTTCGTAAAGATGTTCGGCGAACACGTCGGAAGGAGCTGCTTCGCGTTTGGAACCGAAGTTAGCGAGTCTGTCGGCTGCTT[C/T]
GTTATTGTGCCGAAGGACGTGGGTTAGTTCGAGCCCATCAAACTTGTCTTCCAACTTGCATACCTCTTGCCGATAGGCGGTCATGTTGTCATCAAGGCAG

Reverse complement sequence

CTGCCTTGATGACAACATGACCGCCTATCGGCAAGAGGTATGCAAGTTGGAAGACAAGTTTGATGGGCTCGAACTAACCCACGTCCTTCGGCACAATAAC[G/A]
AAGCAGCCGACAGACTCGCTAACTTCGGTTCCAAACGCGAAGCAGCTCCTTCCGACGTGTTCGCCGAACATCTTTACGAACCAACCGTACCAAGGAAAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.80% 2.70% 35.57% 28.97% NA
All Indica  2759 10.90% 4.00% 51.98% 33.09% NA
All Japonica  1512 72.20% 0.00% 3.24% 24.60% NA
Aus  269 22.70% 4.80% 54.28% 18.22% NA
Indica I  595 10.40% 4.00% 36.47% 49.08% NA
Indica II  465 14.40% 1.50% 45.59% 38.49% NA
Indica III  913 6.00% 4.90% 70.43% 18.62% NA
Indica Intermediate  786 14.90% 4.50% 46.06% 34.61% NA
Temperate Japonica  767 92.70% 0.00% 2.09% 5.22% NA
Tropical Japonica  504 37.10% 0.00% 3.37% 59.52% NA
Japonica Intermediate  241 80.10% 0.00% 6.64% 13.28% NA
VI/Aromatic  96 56.20% 0.00% 29.17% 14.58% NA
Intermediate  90 47.80% 2.20% 26.67% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216728475 C -> DEL LOC_Os12g28290.1 N frameshift_variant Average:6.138; most accessible tissue: Callus, score: 17.979 N N N N
vg1216728475 C -> T LOC_Os12g28290.1 missense_variant ; p.Glu1261Lys; MODERATE nonsynonymous_codon ; E1261K Average:6.138; most accessible tissue: Callus, score: 17.979 benign 1.426 DELETERIOUS 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216728475 NA 4.28E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 4.86E-17 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 5.79E-12 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 4.23E-06 5.22E-08 mr1350 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 3.88E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 3.55E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 6.50E-08 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 2.11E-07 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 9.10E-07 NA mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 5.27E-07 6.44E-24 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 3.57E-09 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 8.22E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 3.54E-08 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 1.51E-19 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 9.21E-07 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 7.29E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 1.37E-15 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 4.16E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 6.11E-06 mr1577_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 9.22E-06 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 4.30E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 6.21E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 1.32E-12 mr1610_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 9.15E-11 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 9.65E-06 4.03E-21 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 3.98E-10 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 2.85E-16 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475 NA 3.67E-15 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251