Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216728475:

Variant ID: vg1216728475 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16728475
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTTTCCTTGGTACGGTTGGTTCGTAAAGATGTTCGGCGAACACGTCGGAAGGAGCTGCTTCGCGTTTGGAACCGAAGTTAGCGAGTCTGTCGGCTGCTT[C/T]
GTTATTGTGCCGAAGGACGTGGGTTAGTTCGAGCCCATCAAACTTGTCTTCCAACTTGCATACCTCTTGCCGATAGGCGGTCATGTTGTCATCAAGGCAG

Reverse complement sequence

CTGCCTTGATGACAACATGACCGCCTATCGGCAAGAGGTATGCAAGTTGGAAGACAAGTTTGATGGGCTCGAACTAACCCACGTCCTTCGGCACAATAAC[G/A]
AAGCAGCCGACAGACTCGCTAACTTCGGTTCCAAACGCGAAGCAGCTCCTTCCGACGTGTTCGCCGAACATCTTTACGAACCAACCGTACCAAGGAAAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.80%	2.70%	35.57%	28.97%	NA
All Indica	2759	10.90%	4.00%	51.98%	33.09%	NA
All Japonica	1512	72.20%	0.00%	3.24%	24.60%	NA
Aus	269	22.70%	4.80%	54.28%	18.22%	NA
Indica I	595	10.40%	4.00%	36.47%	49.08%	NA
Indica II	465	14.40%	1.50%	45.59%	38.49%	NA
Indica III	913	6.00%	4.90%	70.43%	18.62%	NA
Indica Intermediate	786	14.90%	4.50%	46.06%	34.61%	NA
Temperate Japonica	767	92.70%	0.00%	2.09%	5.22%	NA
Tropical Japonica	504	37.10%	0.00%	3.37%	59.52%	NA
Japonica Intermediate	241	80.10%	0.00%	6.64%	13.28%	NA
VI/Aromatic	96	56.20%	0.00%	29.17%	14.58%	NA
Intermediate	90	47.80%	2.20%	26.67%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216728475	C -> DEL	LOC_Os12g28290.1	N	frameshift_variant	Average:6.138; most accessible tissue: Callus, score: 17.979	N	N	N	N
vg1216728475	C -> T	LOC_Os12g28290.1	missense_variant ; p.Glu1261Lys; MODERATE	nonsynonymous_codon ; E1261K	Average:6.138; most accessible tissue: Callus, score: 17.979	benign	1.426	DELETERIOUS	0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216728475	NA	4.28E-09	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	4.86E-17	mr1308	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	5.79E-12	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	4.23E-06	5.22E-08	mr1350	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	3.88E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	3.55E-07	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	6.50E-08	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	2.11E-07	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	9.10E-07	NA	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	5.27E-07	6.44E-24	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	3.57E-09	mr1914	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	8.22E-07	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	3.54E-08	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	1.51E-19	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	9.21E-07	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	7.29E-07	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	1.37E-15	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	4.16E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	6.11E-06	mr1577_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	9.22E-06	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	4.30E-08	mr1599_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	6.21E-07	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	1.32E-12	mr1610_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	9.15E-11	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	9.65E-06	4.03E-21	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	3.98E-10	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	2.85E-16	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728475	NA	3.67E-15	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251