\
| Variant ID: vg1216720660 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16720660 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 42. )
CTCCAATCCATCCTCCAAAACTCCGCGAAATCCTTCTGCGCACCCACCGCACCGATTCCCCATCCCCTTCCAGCCATATCTCAGACCAAATTAAACCATC[T/C]
AGTTCACATTCATGGCGGAAGAGAGAGAAAGCTTCGAGAGTCAGTGGGCGCCCTCCGATGTGACGGAGGAGAATCTGAAAGAGATGGTGGCGCACGGCGT
ACGCCGTGCGCCACCATCTCTTTCAGATTCTCCTCCGTCACATCGGAGGGCGCCCACTGACTCTCGAAGCTTTCTCTCTCTTCCGCCATGAATGTGAACT[A/G]
GATGGTTTAATTTGGTCTGAGATATGGCTGGAAGGGGATGGGGAATCGGTGCGGTGGGTGCGCAGAAGGATTTCGCGGAGTTTTGGAGGATGGATTGGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.80% | 15.60% | 2.67% | 17.90% | NA |
| All Indica | 2759 | 75.10% | 3.20% | 2.43% | 19.28% | NA |
| All Japonica | 1512 | 51.90% | 41.70% | 1.92% | 4.50% | NA |
| Aus | 269 | 18.20% | 1.50% | 5.95% | 74.35% | NA |
| Indica I | 595 | 49.20% | 4.90% | 4.37% | 41.51% | NA |
| Indica II | 465 | 82.60% | 4.10% | 3.87% | 9.46% | NA |
| Indica III | 913 | 88.10% | 0.50% | 0.66% | 10.73% | NA |
| Indica Intermediate | 786 | 75.20% | 4.50% | 2.16% | 18.19% | NA |
| Temperate Japonica | 767 | 17.90% | 75.60% | 1.30% | 5.22% | NA |
| Tropical Japonica | 504 | 93.50% | 1.40% | 2.58% | 2.58% | NA |
| Japonica Intermediate | 241 | 73.40% | 17.80% | 2.49% | 6.22% | NA |
| VI/Aromatic | 96 | 59.40% | 0.00% | 7.29% | 33.33% | NA |
| Intermediate | 90 | 57.80% | 18.90% | 7.78% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216720660 | T -> C | LOC_Os12g28280.1 | upstream_gene_variant ; 12.0bp to feature; MODIFIER | silent_mutation | Average:18.021; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1216720660 | T -> C | LOC_Os12g28270-LOC_Os12g28280 | intergenic_region ; MODIFIER | silent_mutation | Average:18.021; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1216720660 | T -> DEL | N | N | silent_mutation | Average:18.021; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216720660 | NA | 2.08E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216720660 | NA | 2.80E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216720660 | NA | 7.52E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216720660 | NA | 1.99E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216720660 | NA | 2.13E-06 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216720660 | NA | 8.82E-07 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216720660 | 4.40E-06 | 4.39E-06 | mr1777_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216720660 | NA | 3.66E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |