\
| Variant ID: vg1216719017 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16719017 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GAAATACACATGTTCTTGGATCCATTACTCAGCTAATGAGGGCGACACCCCGATTCGTGCCGTTCTCAGGTTCATCGTTAATCTAAGCTAAATCTCTCTT[G/C]
CTTATCAGTATCTATTGATGTGGACTGATTATAGCATTCAAACTAATTTGTTTGTATTCTATTTTTAACAGGTTACTCCCTTCGATTTCTTTGCAGTATC
GATACTGCAAAGAAATCGAAGGGAGTAACCTGTTAAAAATAGAATACAAACAAATTAGTTTGAATGCTATAATCAGTCCACATCAATAGATACTGATAAG[C/G]
AAGAGAGATTTAGCTTAGATTAACGATGAACCTGAGAACGGCACGAATCGGGGTGTCGCCCTCATTAGCTGAGTAATGGATCCAAGAACATGTGTATTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.60% | 24.20% | 1.52% | 12.72% | NA |
| All Indica | 2759 | 95.70% | 2.40% | 0.18% | 1.74% | NA |
| All Japonica | 1512 | 4.20% | 68.60% | 2.31% | 24.93% | NA |
| Aus | 269 | 55.00% | 5.20% | 10.04% | 29.74% | NA |
| Indica I | 595 | 94.50% | 2.70% | 0.34% | 2.52% | NA |
| Indica II | 465 | 94.00% | 2.80% | 0.00% | 3.23% | NA |
| Indica III | 913 | 99.70% | 0.10% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 93.10% | 4.50% | 0.38% | 2.04% | NA |
| Temperate Japonica | 767 | 2.00% | 91.90% | 3.39% | 2.74% | NA |
| Tropical Japonica | 504 | 6.00% | 29.80% | 0.79% | 63.49% | NA |
| Japonica Intermediate | 241 | 7.50% | 75.50% | 2.07% | 14.94% | NA |
| VI/Aromatic | 96 | 15.60% | 0.00% | 4.17% | 80.21% | NA |
| Intermediate | 90 | 46.70% | 31.10% | 1.11% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216719017 | G -> C | LOC_Os12g28280.1 | upstream_gene_variant ; 1655.0bp to feature; MODIFIER | silent_mutation | Average:59.993; most accessible tissue: Callus, score: 86.676 | N | N | N | N |
| vg1216719017 | G -> C | LOC_Os12g28270-LOC_Os12g28280 | intergenic_region ; MODIFIER | silent_mutation | Average:59.993; most accessible tissue: Callus, score: 86.676 | N | N | N | N |
| vg1216719017 | G -> DEL | N | N | silent_mutation | Average:59.993; most accessible tissue: Callus, score: 86.676 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216719017 | NA | 1.14E-09 | mr1093 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216719017 | NA | 1.18E-07 | mr1599 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216719017 | 2.87E-07 | NA | mr1156_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216719017 | NA | 5.71E-06 | mr1623_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216719017 | NA | 1.04E-06 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |