\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216719017:

Variant ID: vg1216719017 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16719017
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAATACACATGTTCTTGGATCCATTACTCAGCTAATGAGGGCGACACCCCGATTCGTGCCGTTCTCAGGTTCATCGTTAATCTAAGCTAAATCTCTCTT[G/C]
CTTATCAGTATCTATTGATGTGGACTGATTATAGCATTCAAACTAATTTGTTTGTATTCTATTTTTAACAGGTTACTCCCTTCGATTTCTTTGCAGTATC

Reverse complement sequence

GATACTGCAAAGAAATCGAAGGGAGTAACCTGTTAAAAATAGAATACAAACAAATTAGTTTGAATGCTATAATCAGTCCACATCAATAGATACTGATAAG[C/G]
AAGAGAGATTTAGCTTAGATTAACGATGAACCTGAGAACGGCACGAATCGGGGTGTCGCCCTCATTAGCTGAGTAATGGATCCAAGAACATGTGTATTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.60% 24.20% 1.52% 12.72% NA
All Indica  2759 95.70% 2.40% 0.18% 1.74% NA
All Japonica  1512 4.20% 68.60% 2.31% 24.93% NA
Aus  269 55.00% 5.20% 10.04% 29.74% NA
Indica I  595 94.50% 2.70% 0.34% 2.52% NA
Indica II  465 94.00% 2.80% 0.00% 3.23% NA
Indica III  913 99.70% 0.10% 0.00% 0.22% NA
Indica Intermediate  786 93.10% 4.50% 0.38% 2.04% NA
Temperate Japonica  767 2.00% 91.90% 3.39% 2.74% NA
Tropical Japonica  504 6.00% 29.80% 0.79% 63.49% NA
Japonica Intermediate  241 7.50% 75.50% 2.07% 14.94% NA
VI/Aromatic  96 15.60% 0.00% 4.17% 80.21% NA
Intermediate  90 46.70% 31.10% 1.11% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216719017 G -> C LOC_Os12g28280.1 upstream_gene_variant ; 1655.0bp to feature; MODIFIER silent_mutation Average:59.993; most accessible tissue: Callus, score: 86.676 N N N N
vg1216719017 G -> C LOC_Os12g28270-LOC_Os12g28280 intergenic_region ; MODIFIER silent_mutation Average:59.993; most accessible tissue: Callus, score: 86.676 N N N N
vg1216719017 G -> DEL N N silent_mutation Average:59.993; most accessible tissue: Callus, score: 86.676 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216719017 NA 1.14E-09 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216719017 NA 1.18E-07 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216719017 2.87E-07 NA mr1156_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216719017 NA 5.71E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216719017 NA 1.04E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251