Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216680785:

Variant ID: vg1216680785 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16680785
Reference Allele: C	Alternative Allele: G,A,T
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGACACACAAGCAGGGAGCTACTCATTCTTTTATAAAATATCTAAGCTAAGTGGAAAGAAAAGAGAAAGAGAATCTATTCCTATACTTCTAGTATACATA[C/G,A,T]
TATATATACATCCTAATTATCTGATATACTAGCTAATACCCTCTATCCAATGCCCTCCTGGTACTTCGAAAAGCCACCCCTGACTGCCGAGTTCCTTACG

Reverse complement sequence

CGTAAGGAACTCGGCAGTCAGGGGTGGCTTTTCGAAGTACCAGGAGGGCATTGGATAGAGGGTATTAGCTAGTATATCAGATAATTAGGATGTATATATA[G/C,T,A]
TATGTATACTAGAAGTATAGGAATAGATTCTCTTTCTCTTTTCTTTCCACTTAGCTTAGATATTTTATAAAAGAATGAGTAGCTCCCTGCTTGTGTGTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.10%	23.50%	17.94%	9.54%	A: 8.93%; T: 0.04%
All Indica	2759	55.20%	3.90%	17.94%	8.23%	A: 14.72%; T: 0.04%
All Japonica	1512	20.20%	61.00%	5.36%	12.70%	A: 0.60%; T: 0.07%
Aus	269	9.70%	11.20%	73.61%	4.83%	A: 0.74%
Indica I	595	75.50%	1.80%	9.41%	10.76%	A: 2.52%
Indica II	465	34.60%	4.90%	15.70%	6.02%	A: 38.71%
Indica III	913	58.40%	2.30%	21.03%	8.87%	A: 9.31%; T: 0.11%
Indica Intermediate	786	48.20%	6.70%	22.14%	6.87%	A: 16.03%
Temperate Japonica	767	11.70%	84.60%	0.52%	2.61%	A: 0.52%
Tropical Japonica	504	25.80%	30.20%	13.29%	29.96%	A: 0.79%
Japonica Intermediate	241	35.70%	50.60%	4.15%	8.71%	T: 0.41%; A: 0.41%
VI/Aromatic	96	6.20%	20.80%	59.38%	12.50%	A: 1.04%
Intermediate	90	37.80%	31.10%	18.89%	7.78%	A: 4.44%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216680785	C -> A	LOC_Os12g28240.1	upstream_gene_variant ; 920.0bp to feature; MODIFIER	silent_mutation	Average:27.476; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg1216680785	C -> A	LOC_Os12g28240-LOC_Os12g28250	intergenic_region ; MODIFIER	silent_mutation	Average:27.476; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg1216680785	C -> DEL	N	N	silent_mutation	Average:27.476; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg1216680785	C -> G	LOC_Os12g28240.1	upstream_gene_variant ; 920.0bp to feature; MODIFIER	silent_mutation	Average:27.476; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg1216680785	C -> G	LOC_Os12g28240-LOC_Os12g28250	intergenic_region ; MODIFIER	silent_mutation	Average:27.476; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg1216680785	C -> T	LOC_Os12g28240.1	upstream_gene_variant ; 920.0bp to feature; MODIFIER	silent_mutation	Average:27.476; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N
vg1216680785	C -> T	LOC_Os12g28240-LOC_Os12g28250	intergenic_region ; MODIFIER	silent_mutation	Average:27.476; most accessible tissue: Zhenshan97 flag leaf, score: 56.722	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216680785	NA	1.84E-12	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	6.11E-06	2.18E-10	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	1.11E-06	9.97E-14	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	1.01E-06	1.84E-12	mr1023	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	NA	2.09E-11	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	7.43E-06	4.55E-14	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	6.27E-06	1.25E-10	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	NA	1.13E-10	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	NA	1.32E-06	mr1168	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	4.73E-06	NA	mr1178	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	2.87E-07	6.74E-13	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	NA	1.10E-12	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	NA	6.31E-08	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	NA	1.83E-11	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	NA	2.08E-10	mr1491	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	NA	1.52E-06	mr1803	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	NA	1.32E-12	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	NA	2.11E-11	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	2.96E-07	2.95E-07	mr1162_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	NA	3.49E-14	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785	NA	1.22E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251