\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216680785:

Variant ID: vg1216680785 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16680785
Reference Allele: CAlternative Allele: G,A,T
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGACACACAAGCAGGGAGCTACTCATTCTTTTATAAAATATCTAAGCTAAGTGGAAAGAAAAGAGAAAGAGAATCTATTCCTATACTTCTAGTATACATA[C/G,A,T]
TATATATACATCCTAATTATCTGATATACTAGCTAATACCCTCTATCCAATGCCCTCCTGGTACTTCGAAAAGCCACCCCTGACTGCCGAGTTCCTTACG

Reverse complement sequence

CGTAAGGAACTCGGCAGTCAGGGGTGGCTTTTCGAAGTACCAGGAGGGCATTGGATAGAGGGTATTAGCTAGTATATCAGATAATTAGGATGTATATATA[G/C,T,A]
TATGTATACTAGAAGTATAGGAATAGATTCTCTTTCTCTTTTCTTTCCACTTAGCTTAGATATTTTATAAAAGAATGAGTAGCTCCCTGCTTGTGTGTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.10% 23.50% 17.94% 9.54% A: 8.93%; T: 0.04%
All Indica  2759 55.20% 3.90% 17.94% 8.23% A: 14.72%; T: 0.04%
All Japonica  1512 20.20% 61.00% 5.36% 12.70% A: 0.60%; T: 0.07%
Aus  269 9.70% 11.20% 73.61% 4.83% A: 0.74%
Indica I  595 75.50% 1.80% 9.41% 10.76% A: 2.52%
Indica II  465 34.60% 4.90% 15.70% 6.02% A: 38.71%
Indica III  913 58.40% 2.30% 21.03% 8.87% A: 9.31%; T: 0.11%
Indica Intermediate  786 48.20% 6.70% 22.14% 6.87% A: 16.03%
Temperate Japonica  767 11.70% 84.60% 0.52% 2.61% A: 0.52%
Tropical Japonica  504 25.80% 30.20% 13.29% 29.96% A: 0.79%
Japonica Intermediate  241 35.70% 50.60% 4.15% 8.71% T: 0.41%; A: 0.41%
VI/Aromatic  96 6.20% 20.80% 59.38% 12.50% A: 1.04%
Intermediate  90 37.80% 31.10% 18.89% 7.78% A: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216680785 C -> A LOC_Os12g28240.1 upstream_gene_variant ; 920.0bp to feature; MODIFIER silent_mutation Average:27.476; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg1216680785 C -> A LOC_Os12g28240-LOC_Os12g28250 intergenic_region ; MODIFIER silent_mutation Average:27.476; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg1216680785 C -> DEL N N silent_mutation Average:27.476; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg1216680785 C -> G LOC_Os12g28240.1 upstream_gene_variant ; 920.0bp to feature; MODIFIER silent_mutation Average:27.476; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg1216680785 C -> G LOC_Os12g28240-LOC_Os12g28250 intergenic_region ; MODIFIER silent_mutation Average:27.476; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg1216680785 C -> T LOC_Os12g28240.1 upstream_gene_variant ; 920.0bp to feature; MODIFIER silent_mutation Average:27.476; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg1216680785 C -> T LOC_Os12g28240-LOC_Os12g28250 intergenic_region ; MODIFIER silent_mutation Average:27.476; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216680785 NA 1.84E-12 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 6.11E-06 2.18E-10 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 1.11E-06 9.97E-14 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 1.01E-06 1.84E-12 mr1023 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 NA 2.09E-11 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 7.43E-06 4.55E-14 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 6.27E-06 1.25E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 NA 1.13E-10 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 NA 1.32E-06 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 4.73E-06 NA mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 2.87E-07 6.74E-13 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 NA 1.10E-12 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 NA 6.31E-08 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 NA 1.83E-11 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 NA 2.08E-10 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 NA 1.52E-06 mr1803 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 NA 1.32E-12 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 NA 2.11E-11 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 2.96E-07 2.95E-07 mr1162_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 NA 3.49E-14 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680785 NA 1.22E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251