\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216680196:

Variant ID: vg1216680196 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16680196
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.53, A: 0.47, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


CTGTTCGAGTTGCTCATCAGGCATGGCATTAATCAAAGCAAGAGAGGTAGAATTATGTCAGGGTTACGGATAAGGCATACCTTCTATCCTACGACTTATA[A/G]
AATACATCGATAAGGTATATCTTCACGTACACGAATCGTTTCCATGTACACTATTTGGAGTTTGTTCTAAATTATGGAAAATATGTCTACAGGTCAAGAG

Reverse complement sequence

CTCTTGACCTGTAGACATATTTTCCATAATTTAGAACAAACTCCAAATAGTGTACATGGAAACGATTCGTGTACGTGAAGATATACCTTATCGATGTATT[T/C]
TATAAGTCGTAGGATAGAAGGTATGCCTTATCCGTAACCCTGACATAATTCTACCTCTCTTGCTTTGATTAATGCCATGCCTGATGAGCAACTCGAACAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.40% 25.50% 0.21% 28.97% NA
All Indica  2759 74.10% 2.30% 0.07% 23.52% NA
All Japonica  1512 3.20% 71.80% 0.46% 24.47% NA
Aus  269 3.00% 8.60% 0.37% 88.10% NA
Indica I  595 89.20% 1.30% 0.00% 9.41% NA
Indica II  465 74.40% 2.80% 0.00% 22.80% NA
Indica III  913 70.60% 0.30% 0.11% 28.92% NA
Indica Intermediate  786 66.40% 5.10% 0.13% 28.37% NA
Temperate Japonica  767 1.30% 96.10% 0.00% 2.61% NA
Tropical Japonica  504 4.40% 31.70% 1.19% 62.70% NA
Japonica Intermediate  241 7.10% 78.40% 0.41% 14.11% NA
VI/Aromatic  96 9.40% 1.00% 0.00% 89.58% NA
Intermediate  90 37.80% 32.20% 0.00% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216680196 A -> DEL N N silent_mutation Average:25.091; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1216680196 A -> G LOC_Os12g28240.1 upstream_gene_variant ; 331.0bp to feature; MODIFIER silent_mutation Average:25.091; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1216680196 A -> G LOC_Os12g28230.1 downstream_gene_variant ; 4758.0bp to feature; MODIFIER silent_mutation Average:25.091; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1216680196 A -> G LOC_Os12g28240-LOC_Os12g28250 intergenic_region ; MODIFIER silent_mutation Average:25.091; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216680196 NA 8.15E-14 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 9.51E-07 3.41E-12 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 3.04E-06 NA mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 2.54E-08 2.40E-16 mr1022 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 3.88E-07 1.45E-13 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 6.20E-06 4.51E-13 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 1.23E-06 2.10E-16 mr1079 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 3.68E-06 8.88E-12 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 NA 3.30E-12 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 2.41E-08 9.25E-15 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 NA 5.95E-15 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 5.78E-06 2.39E-09 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 NA 2.75E-13 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 NA 9.02E-12 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 NA 3.35E-06 mr1803 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 NA 9.21E-15 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 NA 5.86E-10 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 NA 3.29E-15 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 NA 3.74E-13 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 NA 4.63E-13 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 7.83E-06 4.51E-15 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 NA 1.49E-12 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216680196 NA 3.68E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251