\
| Variant ID: vg1216679292 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16679292 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAACCTATTTTTTTCAAATTAGCACAATTTTCACAATCTATCATAACACCTTTGCTTTTACAACATTTGGGGCAAGAAAGCACTTCATTAGTTTTCACAA[C/T]
ATCCTCCATGTACTCAACACGACCTAATGCATCTTTTAGCCTCAACTTGTTTAGTGTGCATGTTGAGCAATTCAAAACACCATGTTGTTCTTTTTAACTT
AAGTTAAAAAGAACAACATGGTGTTTTGAATTGCTCAACATGCACACTAAACAAGTTGAGGCTAAAAGATGCATTAGGTCGTGTTGAGTACATGGAGGAT[G/A]
TTGTGAAAACTAATGAAGTGCTTTCTTGCCCCAAATGTTGTAAAAGCAAAGGTGTTATGATAGATTGTGAAAATTGTGCTAATTTGAAAAAAATAGGTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.20% | 25.40% | 0.30% | 29.07% | NA |
| All Indica | 2759 | 73.80% | 2.40% | 0.40% | 23.41% | NA |
| All Japonica | 1512 | 3.20% | 71.60% | 0.07% | 25.13% | NA |
| Aus | 269 | 3.00% | 8.60% | 0.37% | 88.10% | NA |
| Indica I | 595 | 88.60% | 1.70% | 0.17% | 9.58% | NA |
| Indica II | 465 | 74.20% | 3.40% | 0.22% | 22.15% | NA |
| Indica III | 913 | 70.50% | 0.30% | 0.55% | 28.59% | NA |
| Indica Intermediate | 786 | 66.20% | 4.70% | 0.51% | 28.63% | NA |
| Temperate Japonica | 767 | 1.30% | 96.00% | 0.13% | 2.61% | NA |
| Tropical Japonica | 504 | 4.20% | 31.20% | 0.00% | 64.68% | NA |
| Japonica Intermediate | 241 | 7.10% | 78.80% | 0.00% | 14.11% | NA |
| VI/Aromatic | 96 | 9.40% | 1.00% | 0.00% | 89.58% | NA |
| Intermediate | 90 | 40.00% | 31.10% | 1.11% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216679292 | C -> DEL | N | N | silent_mutation | Average:14.621; most accessible tissue: Callus, score: 48.349 | N | N | N | N |
| vg1216679292 | C -> T | LOC_Os12g28230.1 | downstream_gene_variant ; 3854.0bp to feature; MODIFIER | silent_mutation | Average:14.621; most accessible tissue: Callus, score: 48.349 | N | N | N | N |
| vg1216679292 | C -> T | LOC_Os12g28240.1 | intron_variant ; MODIFIER | silent_mutation | Average:14.621; most accessible tissue: Callus, score: 48.349 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216679292 | NA | 2.95E-35 | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216679292 | NA | 9.47E-28 | mr1022 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216679292 | 3.34E-06 | 8.65E-12 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216679292 | NA | 5.04E-34 | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216679292 | NA | 1.22E-09 | mr1132 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216679292 | NA | 2.28E-60 | mr1142 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216679292 | 5.80E-06 | 1.43E-11 | mr1142 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216679292 | 7.16E-07 | NA | mr1178 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216679292 | NA | 3.24E-07 | mr1334 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216679292 | 2.89E-06 | 3.84E-09 | mr1489 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216679292 | NA | 2.22E-52 | mr1490 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216679292 | NA | 2.59E-06 | mr1792_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216679292 | NA | 3.64E-06 | mr1803_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |