\
| Variant ID: vg1216678067 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16678067 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAGTCAAACCACGAACAAGATCCAAACCACTTAACCTCGTGAGATGATCAAAACCAACATATCCAAGTCCACAATGCCAAAACATTACATCCTTATTAAA[T/C]
TTAGCAACCAAACATGTTATTACAAGTGAAACATGATTTTCAAAATCAGCTTTAAATACTCTTCCATAGCGAGAAATATTCAACACAGAATCACCACAAG
CTTGTGGTGATTCTGTGTTGAATATTTCTCGCTATGGAAGAGTATTTAAAGCTGATTTTGAAAATCATGTTTCACTTGTAATAACATGTTTGGTTGCTAA[A/G]
TTTAATAAGGATGTAATGTTTTGGCATTGTGGACTTGGATATGTTGGTTTTGATCATCTCACGAGGTTAAGTGGTTTGGATCTTGTTCGTGGTTTGACTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.50% | 18.40% | 0.61% | 28.52% | NA |
| All Indica | 2759 | 74.60% | 1.80% | 0.58% | 23.05% | NA |
| All Japonica | 1512 | 22.80% | 52.40% | 0.26% | 24.60% | NA |
| Aus | 269 | 10.80% | 1.50% | 1.49% | 86.25% | NA |
| Indica I | 595 | 89.40% | 1.30% | 0.00% | 9.24% | NA |
| Indica II | 465 | 74.60% | 2.40% | 1.51% | 21.51% | NA |
| Indica III | 913 | 70.90% | 0.10% | 0.44% | 28.59% | NA |
| Indica Intermediate | 786 | 67.60% | 3.80% | 0.64% | 27.99% | NA |
| Temperate Japonica | 767 | 13.00% | 84.40% | 0.00% | 2.61% | NA |
| Tropical Japonica | 504 | 30.40% | 5.80% | 0.79% | 63.10% | NA |
| Japonica Intermediate | 241 | 37.80% | 48.10% | 0.00% | 14.11% | NA |
| VI/Aromatic | 96 | 9.40% | 0.00% | 3.12% | 87.50% | NA |
| Intermediate | 90 | 45.60% | 25.60% | 2.22% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216678067 | T -> C | LOC_Os12g28240.1 | synonymous_variant ; p.Lys176Lys; LOW | synonymous_codon | Average:11.713; most accessible tissue: Callus, score: 29.034 | N | N | N | N |
| vg1216678067 | T -> DEL | LOC_Os12g28240.1 | N | frameshift_variant | Average:11.713; most accessible tissue: Callus, score: 29.034 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216678067 | NA | 3.19E-10 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216678067 | NA | 8.76E-09 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216678067 | NA | 7.47E-09 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216678067 | NA | 7.09E-06 | mr1030_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216678067 | NA | 6.58E-17 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216678067 | 1.18E-08 | 1.18E-08 | mr1162_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216678067 | NA | 2.36E-06 | mr1715_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216678067 | NA | 1.26E-07 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216678067 | NA | 3.22E-08 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216678067 | NA | 2.24E-14 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216678067 | NA | 9.31E-10 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |