\
| Variant ID: vg1216602681 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16602681 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTCGTTCACTGCAACATTAGATCTATACATAGTGAAACATTATGAGTACAATAGGTGAAACATTTTTGGTGGAACAAAAAATGAAACGAATTCTCTTAAT[A/T]
GAGGGTTTTCAAAATATATGTGGGTGATTTGTTGCAAAAGAATACTTTAATTCACTGCAACATTATATCTATACATAGTGAAACATTGTGAGTACACTAG
CTAGTGTACTCACAATGTTTCACTATGTATAGATATAATGTTGCAGTGAATTAAAGTATTCTTTTGCAACAAATCACCCACATATATTTTGAAAACCCTC[T/A]
ATTAAGAGAATTCGTTTCATTTTTTGTTCCACCAAAAATGTTTCACCTATTGTACTCATAATGTTTCACTATGTATAGATCTAATGTTGCAGTGAACGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.10% | 0.10% | 2.86% | 8.91% | NA |
| All Indica | 2759 | 89.50% | 0.10% | 2.43% | 7.94% | NA |
| All Japonica | 1512 | 91.50% | 0.10% | 2.12% | 6.35% | NA |
| Aus | 269 | 53.20% | 0.00% | 10.41% | 36.43% | NA |
| Indica I | 595 | 91.90% | 0.30% | 0.84% | 6.89% | NA |
| Indica II | 465 | 96.10% | 0.00% | 0.86% | 3.01% | NA |
| Indica III | 913 | 85.30% | 0.20% | 4.16% | 10.30% | NA |
| Indica Intermediate | 786 | 88.50% | 0.00% | 2.54% | 8.91% | NA |
| Temperate Japonica | 767 | 97.70% | 0.00% | 0.13% | 2.22% | NA |
| Tropical Japonica | 504 | 81.20% | 0.20% | 4.96% | 13.69% | NA |
| Japonica Intermediate | 241 | 93.40% | 0.00% | 2.49% | 4.15% | NA |
| VI/Aromatic | 96 | 90.60% | 0.00% | 6.25% | 3.12% | NA |
| Intermediate | 90 | 92.20% | 0.00% | 2.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216602681 | A -> DEL | N | N | silent_mutation | Average:8.697; most accessible tissue: Zhenshan97 flower, score: 14.863 | N | N | N | N |
| vg1216602681 | A -> T | LOC_Os12g28110.1 | downstream_gene_variant ; 3763.0bp to feature; MODIFIER | silent_mutation | Average:8.697; most accessible tissue: Zhenshan97 flower, score: 14.863 | N | N | N | N |
| vg1216602681 | A -> T | LOC_Os12g28110-LOC_Os12g28137 | intergenic_region ; MODIFIER | silent_mutation | Average:8.697; most accessible tissue: Zhenshan97 flower, score: 14.863 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216602681 | NA | 6.42E-10 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216602681 | NA | 6.71E-11 | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216602681 | NA | 3.45E-11 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216602681 | NA | 1.36E-06 | mr1060 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216602681 | NA | 3.41E-10 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216602681 | NA | 3.17E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216602681 | NA | 2.93E-11 | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216602681 | NA | 6.70E-12 | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216602681 | NA | 2.54E-12 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216602681 | NA | 2.23E-13 | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216602681 | NA | 5.60E-08 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216602681 | 1.50E-06 | NA | mr1291_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216602681 | NA | 2.58E-15 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216602681 | NA | 9.28E-08 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216602681 | NA | 4.53E-06 | mr1483_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216602681 | NA | 5.27E-14 | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216602681 | NA | 4.48E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216602681 | NA | 2.42E-09 | mr1942_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |