\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216602681:

Variant ID: vg1216602681 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16602681
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCGTTCACTGCAACATTAGATCTATACATAGTGAAACATTATGAGTACAATAGGTGAAACATTTTTGGTGGAACAAAAAATGAAACGAATTCTCTTAAT[A/T]
GAGGGTTTTCAAAATATATGTGGGTGATTTGTTGCAAAAGAATACTTTAATTCACTGCAACATTATATCTATACATAGTGAAACATTGTGAGTACACTAG

Reverse complement sequence

CTAGTGTACTCACAATGTTTCACTATGTATAGATATAATGTTGCAGTGAATTAAAGTATTCTTTTGCAACAAATCACCCACATATATTTTGAAAACCCTC[T/A]
ATTAAGAGAATTCGTTTCATTTTTTGTTCCACCAAAAATGTTTCACCTATTGTACTCATAATGTTTCACTATGTATAGATCTAATGTTGCAGTGAACGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.10% 0.10% 2.86% 8.91% NA
All Indica  2759 89.50% 0.10% 2.43% 7.94% NA
All Japonica  1512 91.50% 0.10% 2.12% 6.35% NA
Aus  269 53.20% 0.00% 10.41% 36.43% NA
Indica I  595 91.90% 0.30% 0.84% 6.89% NA
Indica II  465 96.10% 0.00% 0.86% 3.01% NA
Indica III  913 85.30% 0.20% 4.16% 10.30% NA
Indica Intermediate  786 88.50% 0.00% 2.54% 8.91% NA
Temperate Japonica  767 97.70% 0.00% 0.13% 2.22% NA
Tropical Japonica  504 81.20% 0.20% 4.96% 13.69% NA
Japonica Intermediate  241 93.40% 0.00% 2.49% 4.15% NA
VI/Aromatic  96 90.60% 0.00% 6.25% 3.12% NA
Intermediate  90 92.20% 0.00% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216602681 A -> DEL N N silent_mutation Average:8.697; most accessible tissue: Zhenshan97 flower, score: 14.863 N N N N
vg1216602681 A -> T LOC_Os12g28110.1 downstream_gene_variant ; 3763.0bp to feature; MODIFIER silent_mutation Average:8.697; most accessible tissue: Zhenshan97 flower, score: 14.863 N N N N
vg1216602681 A -> T LOC_Os12g28110-LOC_Os12g28137 intergenic_region ; MODIFIER silent_mutation Average:8.697; most accessible tissue: Zhenshan97 flower, score: 14.863 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216602681 NA 6.42E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602681 NA 6.71E-11 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602681 NA 3.45E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602681 NA 1.36E-06 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602681 NA 3.41E-10 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602681 NA 3.17E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602681 NA 2.93E-11 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602681 NA 6.70E-12 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602681 NA 2.54E-12 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602681 NA 2.23E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602681 NA 5.60E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602681 1.50E-06 NA mr1291_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602681 NA 2.58E-15 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602681 NA 9.28E-08 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602681 NA 4.53E-06 mr1483_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602681 NA 5.27E-14 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602681 NA 4.48E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216602681 NA 2.42E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251