| Variant ID: vg1216585567 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16585567 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, A: 0.18, others allele: 0.00, population size: 94. )
AAGCCGCAGCGCTATCGCTAATTGAAATCGCGGGAGTGCTAATGCATCGGTGTTGCATTTGAAAATCGCAAGAGCGAGGCGGTCCCGCACTTTCGTAAAG[C/A,T]
GATAGCGCGGGTTGTCCGACGTTGTCTGACGCACGTGGGGCACGAAGCAGTCTCGTGCTTTGAGTGAGCGGGAGCGCGTGTGGTATTACGGTCTACTTAC
GTAAGTAGACCGTAATACCACACGCGCTCCCGCTCACTCAAAGCACGAGACTGCTTCGTGCCCCACGTGCGTCAGACAACGTCGGACAACCCGCGCTATC[G/T,A]
CTTTACGAAAGTGCGGGACCGCCTCGCTCTTGCGATTTTCAAATGCAACACCGATGCATTAGCACTCCCGCGATTTCAATTAGCGATAGCGCTGCGGCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.90% | 22.40% | 0.40% | 22.26% | T: 0.02% |
| All Indica | 2759 | 52.90% | 19.70% | 0.58% | 26.82% | NA |
| All Japonica | 1512 | 52.80% | 29.60% | 0.07% | 17.46% | T: 0.07% |
| Aus | 269 | 84.40% | 15.20% | 0.00% | 0.37% | NA |
| Indica I | 595 | 75.30% | 13.40% | 0.00% | 11.26% | NA |
| Indica II | 465 | 58.90% | 14.20% | 0.22% | 26.67% | NA |
| Indica III | 913 | 28.10% | 26.30% | 1.31% | 44.25% | NA |
| Indica Intermediate | 786 | 61.10% | 20.10% | 0.38% | 18.45% | NA |
| Temperate Japonica | 767 | 84.50% | 15.00% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 5.60% | 45.80% | 0.20% | 48.21% | T: 0.20% |
| Japonica Intermediate | 241 | 51.00% | 41.90% | 0.00% | 7.05% | NA |
| VI/Aromatic | 96 | 63.50% | 11.50% | 0.00% | 25.00% | NA |
| Intermediate | 90 | 53.30% | 18.90% | 2.22% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216585567 | C -> DEL | N | N | silent_mutation | Average:30.04; most accessible tissue: Callus, score: 69.809 | N | N | N | N |
| vg1216585567 | C -> A | LOC_Os12g28080.1 | upstream_gene_variant ; 4294.0bp to feature; MODIFIER | silent_mutation | Average:30.04; most accessible tissue: Callus, score: 69.809 | N | N | N | N |
| vg1216585567 | C -> A | LOC_Os12g28090.1 | downstream_gene_variant ; 213.0bp to feature; MODIFIER | silent_mutation | Average:30.04; most accessible tissue: Callus, score: 69.809 | N | N | N | N |
| vg1216585567 | C -> A | LOC_Os12g28100.1 | downstream_gene_variant ; 3495.0bp to feature; MODIFIER | silent_mutation | Average:30.04; most accessible tissue: Callus, score: 69.809 | N | N | N | N |
| vg1216585567 | C -> A | LOC_Os12g28090-LOC_Os12g28100 | intergenic_region ; MODIFIER | silent_mutation | Average:30.04; most accessible tissue: Callus, score: 69.809 | N | N | N | N |
| vg1216585567 | C -> T | LOC_Os12g28080.1 | upstream_gene_variant ; 4294.0bp to feature; MODIFIER | silent_mutation | Average:30.04; most accessible tissue: Callus, score: 69.809 | N | N | N | N |
| vg1216585567 | C -> T | LOC_Os12g28090.1 | downstream_gene_variant ; 213.0bp to feature; MODIFIER | silent_mutation | Average:30.04; most accessible tissue: Callus, score: 69.809 | N | N | N | N |
| vg1216585567 | C -> T | LOC_Os12g28100.1 | downstream_gene_variant ; 3495.0bp to feature; MODIFIER | silent_mutation | Average:30.04; most accessible tissue: Callus, score: 69.809 | N | N | N | N |
| vg1216585567 | C -> T | LOC_Os12g28090-LOC_Os12g28100 | intergenic_region ; MODIFIER | silent_mutation | Average:30.04; most accessible tissue: Callus, score: 69.809 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216585567 | 5.38E-06 | NA | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216585567 | 1.22E-06 | NA | mr1018 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216585567 | 8.99E-06 | NA | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216585567 | 9.18E-07 | NA | mr1055 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216585567 | 1.44E-06 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216585567 | 4.29E-06 | NA | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216585567 | 1.96E-06 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216585567 | 6.08E-06 | NA | mr1178_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216585567 | 2.05E-06 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216585567 | 6.81E-07 | NA | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216585567 | 4.16E-07 | NA | mr1490_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216585567 | 6.98E-07 | NA | mr1490_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216585567 | NA | 3.46E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |