\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216585567:

Variant ID: vg1216585567 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16585567
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, A: 0.18, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCCGCAGCGCTATCGCTAATTGAAATCGCGGGAGTGCTAATGCATCGGTGTTGCATTTGAAAATCGCAAGAGCGAGGCGGTCCCGCACTTTCGTAAAG[C/A,T]
GATAGCGCGGGTTGTCCGACGTTGTCTGACGCACGTGGGGCACGAAGCAGTCTCGTGCTTTGAGTGAGCGGGAGCGCGTGTGGTATTACGGTCTACTTAC

Reverse complement sequence

GTAAGTAGACCGTAATACCACACGCGCTCCCGCTCACTCAAAGCACGAGACTGCTTCGTGCCCCACGTGCGTCAGACAACGTCGGACAACCCGCGCTATC[G/T,A]
CTTTACGAAAGTGCGGGACCGCCTCGCTCTTGCGATTTTCAAATGCAACACCGATGCATTAGCACTCCCGCGATTTCAATTAGCGATAGCGCTGCGGCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.90% 22.40% 0.40% 22.26% T: 0.02%
All Indica  2759 52.90% 19.70% 0.58% 26.82% NA
All Japonica  1512 52.80% 29.60% 0.07% 17.46% T: 0.07%
Aus  269 84.40% 15.20% 0.00% 0.37% NA
Indica I  595 75.30% 13.40% 0.00% 11.26% NA
Indica II  465 58.90% 14.20% 0.22% 26.67% NA
Indica III  913 28.10% 26.30% 1.31% 44.25% NA
Indica Intermediate  786 61.10% 20.10% 0.38% 18.45% NA
Temperate Japonica  767 84.50% 15.00% 0.00% 0.52% NA
Tropical Japonica  504 5.60% 45.80% 0.20% 48.21% T: 0.20%
Japonica Intermediate  241 51.00% 41.90% 0.00% 7.05% NA
VI/Aromatic  96 63.50% 11.50% 0.00% 25.00% NA
Intermediate  90 53.30% 18.90% 2.22% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216585567 C -> DEL N N silent_mutation Average:30.04; most accessible tissue: Callus, score: 69.809 N N N N
vg1216585567 C -> A LOC_Os12g28080.1 upstream_gene_variant ; 4294.0bp to feature; MODIFIER silent_mutation Average:30.04; most accessible tissue: Callus, score: 69.809 N N N N
vg1216585567 C -> A LOC_Os12g28090.1 downstream_gene_variant ; 213.0bp to feature; MODIFIER silent_mutation Average:30.04; most accessible tissue: Callus, score: 69.809 N N N N
vg1216585567 C -> A LOC_Os12g28100.1 downstream_gene_variant ; 3495.0bp to feature; MODIFIER silent_mutation Average:30.04; most accessible tissue: Callus, score: 69.809 N N N N
vg1216585567 C -> A LOC_Os12g28090-LOC_Os12g28100 intergenic_region ; MODIFIER silent_mutation Average:30.04; most accessible tissue: Callus, score: 69.809 N N N N
vg1216585567 C -> T LOC_Os12g28080.1 upstream_gene_variant ; 4294.0bp to feature; MODIFIER silent_mutation Average:30.04; most accessible tissue: Callus, score: 69.809 N N N N
vg1216585567 C -> T LOC_Os12g28090.1 downstream_gene_variant ; 213.0bp to feature; MODIFIER silent_mutation Average:30.04; most accessible tissue: Callus, score: 69.809 N N N N
vg1216585567 C -> T LOC_Os12g28100.1 downstream_gene_variant ; 3495.0bp to feature; MODIFIER silent_mutation Average:30.04; most accessible tissue: Callus, score: 69.809 N N N N
vg1216585567 C -> T LOC_Os12g28090-LOC_Os12g28100 intergenic_region ; MODIFIER silent_mutation Average:30.04; most accessible tissue: Callus, score: 69.809 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216585567 5.38E-06 NA mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567 1.22E-06 NA mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567 8.99E-06 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567 9.18E-07 NA mr1055 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567 1.44E-06 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567 4.29E-06 NA mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567 1.96E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567 6.08E-06 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567 2.05E-06 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567 6.81E-07 NA mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567 4.16E-07 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567 6.98E-07 NA mr1490_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567 NA 3.46E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251