Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1216585567:

Variant ID: vg1216585567 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16585567
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, A: 0.18, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

AAGCCGCAGCGCTATCGCTAATTGAAATCGCGGGAGTGCTAATGCATCGGTGTTGCATTTGAAAATCGCAAGAGCGAGGCGGTCCCGCACTTTCGTAAAG[C/A,T]
GATAGCGCGGGTTGTCCGACGTTGTCTGACGCACGTGGGGCACGAAGCAGTCTCGTGCTTTGAGTGAGCGGGAGCGCGTGTGGTATTACGGTCTACTTAC

Reverse complement sequence

GTAAGTAGACCGTAATACCACACGCGCTCCCGCTCACTCAAAGCACGAGACTGCTTCGTGCCCCACGTGCGTCAGACAACGTCGGACAACCCGCGCTATC[G/T,A]
CTTTACGAAAGTGCGGGACCGCCTCGCTCTTGCGATTTTCAAATGCAACACCGATGCATTAGCACTCCCGCGATTTCAATTAGCGATAGCGCTGCGGCTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.90%	22.40%	0.40%	22.26%	T: 0.02%
All Indica	2759	52.90%	19.70%	0.58%	26.82%	NA
All Japonica	1512	52.80%	29.60%	0.07%	17.46%	T: 0.07%
Aus	269	84.40%	15.20%	0.00%	0.37%	NA
Indica I	595	75.30%	13.40%	0.00%	11.26%	NA
Indica II	465	58.90%	14.20%	0.22%	26.67%	NA
Indica III	913	28.10%	26.30%	1.31%	44.25%	NA
Indica Intermediate	786	61.10%	20.10%	0.38%	18.45%	NA
Temperate Japonica	767	84.50%	15.00%	0.00%	0.52%	NA
Tropical Japonica	504	5.60%	45.80%	0.20%	48.21%	T: 0.20%
Japonica Intermediate	241	51.00%	41.90%	0.00%	7.05%	NA
VI/Aromatic	96	63.50%	11.50%	0.00%	25.00%	NA
Intermediate	90	53.30%	18.90%	2.22%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216585567	C -> DEL	N	N	silent_mutation	Average:30.04; most accessible tissue: Callus, score: 69.809	N	N	N	N
vg1216585567	C -> A	LOC_Os12g28080.1	upstream_gene_variant ; 4294.0bp to feature; MODIFIER	silent_mutation	Average:30.04; most accessible tissue: Callus, score: 69.809	N	N	N	N
vg1216585567	C -> A	LOC_Os12g28090.1	downstream_gene_variant ; 213.0bp to feature; MODIFIER	silent_mutation	Average:30.04; most accessible tissue: Callus, score: 69.809	N	N	N	N
vg1216585567	C -> A	LOC_Os12g28100.1	downstream_gene_variant ; 3495.0bp to feature; MODIFIER	silent_mutation	Average:30.04; most accessible tissue: Callus, score: 69.809	N	N	N	N
vg1216585567	C -> A	LOC_Os12g28090-LOC_Os12g28100	intergenic_region ; MODIFIER	silent_mutation	Average:30.04; most accessible tissue: Callus, score: 69.809	N	N	N	N
vg1216585567	C -> T	LOC_Os12g28080.1	upstream_gene_variant ; 4294.0bp to feature; MODIFIER	silent_mutation	Average:30.04; most accessible tissue: Callus, score: 69.809	N	N	N	N
vg1216585567	C -> T	LOC_Os12g28090.1	downstream_gene_variant ; 213.0bp to feature; MODIFIER	silent_mutation	Average:30.04; most accessible tissue: Callus, score: 69.809	N	N	N	N
vg1216585567	C -> T	LOC_Os12g28100.1	downstream_gene_variant ; 3495.0bp to feature; MODIFIER	silent_mutation	Average:30.04; most accessible tissue: Callus, score: 69.809	N	N	N	N
vg1216585567	C -> T	LOC_Os12g28090-LOC_Os12g28100	intergenic_region ; MODIFIER	silent_mutation	Average:30.04; most accessible tissue: Callus, score: 69.809	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216585567	5.38E-06	NA	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567	1.22E-06	NA	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567	8.99E-06	NA	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567	9.18E-07	NA	mr1055	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567	1.44E-06	NA	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567	4.29E-06	NA	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567	1.96E-06	NA	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567	6.08E-06	NA	mr1178_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567	2.05E-06	NA	mr1390_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567	6.81E-07	NA	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567	4.16E-07	NA	mr1490_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567	6.98E-07	NA	mr1490_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216585567	NA	3.46E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251