\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216582806:

Variant ID: vg1216582806 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16582806
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGCATCTGGCGCACTGCCGCGATGTCATCGCTAAGTCCTGATGCCGTGTCGCCGTCGCTACCTAGAACTGAGAAACTGGTGCTGGCTGTGACCCATCAT[T/C]
GGCCGGCCTGCCTGCCGGAGTCCTTGTCGGCTGCAACGCCTGACGGCCTGATCGTCTACTCTAATCAGCAATCAGGTAATGTAATCCACTAATCCCTATT

Reverse complement sequence

AATAGGGATTAGTGGATTACATTACCTGATTGCTGATTAGAGTAGACGATCAGGCCGTCAGGCGTTGCAGCCGACAAGGACTCCGGCAGGCAGGCCGGCC[A/G]
ATGATGGGTCACAGCCAGCACCAGTTTCTCAGTTCTAGGTAGCGACGGCGACACGGCATCAGGACTTAGCGATGACATCGCGGCAGTGCGCCAGATGCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.70% 17.20% 0.63% 22.47% NA
All Indica  2759 70.10% 1.90% 0.83% 27.15% NA
All Japonica  1512 33.50% 48.80% 0.20% 17.46% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 87.10% 1.50% 0.00% 11.43% NA
Indica II  465 69.00% 2.20% 1.51% 27.31% NA
Indica III  913 53.90% 0.10% 0.55% 45.45% NA
Indica Intermediate  786 76.70% 4.20% 1.40% 17.68% NA
Temperate Japonica  767 19.30% 80.20% 0.13% 0.39% NA
Tropical Japonica  504 47.20% 4.00% 0.40% 48.41% NA
Japonica Intermediate  241 50.20% 42.70% 0.00% 7.05% NA
VI/Aromatic  96 74.00% 0.00% 2.08% 23.96% NA
Intermediate  90 47.80% 23.30% 2.22% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216582806 T -> C LOC_Os12g28090.1 5_prime_UTR_variant ; 936.0bp to feature; MODIFIER silent_mutation Average:41.212; most accessible tissue: Callus, score: 84.533 N N N N
vg1216582806 T -> C LOC_Os12g28070.1 upstream_gene_variant ; 4601.0bp to feature; MODIFIER silent_mutation Average:41.212; most accessible tissue: Callus, score: 84.533 N N N N
vg1216582806 T -> C LOC_Os12g28080.1 upstream_gene_variant ; 1533.0bp to feature; MODIFIER silent_mutation Average:41.212; most accessible tissue: Callus, score: 84.533 N N N N
vg1216582806 T -> DEL N N silent_mutation Average:41.212; most accessible tissue: Callus, score: 84.533 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216582806 NA 8.15E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 NA 1.13E-06 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 NA 3.46E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 NA 4.19E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 NA 1.46E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 NA 1.07E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 7.65E-08 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 NA 8.52E-10 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 NA 4.40E-07 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 NA 4.93E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 7.43E-07 7.43E-07 mr1162_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 NA 9.46E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 7.80E-08 NA mr1203_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 NA 2.91E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 NA 2.96E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 9.29E-09 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 3.19E-06 NA mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 NA 3.00E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 NA 1.47E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 4.57E-06 4.57E-06 mr1754_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 NA 6.89E-09 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 NA 2.64E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216582806 NA 3.38E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251