Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216580086:

Variant ID: vg1216580086 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16580086
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTAGACATATATATGTGTTTAGATTCATTAATATCTATATGGATATGAGCAATACTAGAAAGTCTTACATCGTGAAACAGAGGAAGTAATATCATAAAC[G/T]
TATTTAACTTTAGAAATTTAATTTAATCAACTCTTGTCTTTAACATCGAAAGGAGAGTGATTCTTCTTCCTTTTAATAATAGAAACTGGCACGCTCTTGT

Reverse complement sequence

ACAAGAGCGTGCCAGTTTCTATTATTAAAAGGAAGAAGAATCACTCTCCTTTCGATGTTAAAGACAAGAGTTGATTAAATTAAATTTCTAAAGTTAAATA[C/A]
GTTTATGATATTACTTCCTCTGTTTCACGATGTAAGACTTTCTAGTATTGCTCATATCCATATAGATATTAATGAATCTAAACACATATATATGTCTAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.80%	17.40%	0.34%	22.53%	NA
All Indica	2759	70.00%	2.20%	0.47%	27.29%	NA
All Japonica	1512	33.90%	48.70%	0.00%	17.39%	NA
Aus	269	99.30%	0.00%	0.00%	0.74%	NA
Indica I	595	86.90%	2.00%	0.17%	10.92%	NA
Indica II	465	69.00%	2.40%	0.22%	28.39%	NA
Indica III	913	53.80%	0.40%	0.99%	44.80%	NA
Indica Intermediate	786	76.60%	4.50%	0.25%	18.70%	NA
Temperate Japonica	767	19.80%	79.80%	0.00%	0.39%	NA
Tropical Japonica	504	47.60%	4.20%	0.00%	48.21%	NA
Japonica Intermediate	241	49.80%	43.20%	0.00%	7.05%	NA
VI/Aromatic	96	74.00%	1.00%	1.04%	23.96%	NA
Intermediate	90	48.90%	22.20%	2.22%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216580086	G -> DEL	N	N	silent_mutation	Average:18.63; most accessible tissue: Zhenshan97 root, score: 39.742	N	N	N	N
vg1216580086	G -> T	LOC_Os12g28070.1	upstream_gene_variant ; 1881.0bp to feature; MODIFIER	silent_mutation	Average:18.63; most accessible tissue: Zhenshan97 root, score: 39.742	N	N	N	N
vg1216580086	G -> T	LOC_Os12g28090.1	upstream_gene_variant ; 2568.0bp to feature; MODIFIER	silent_mutation	Average:18.63; most accessible tissue: Zhenshan97 root, score: 39.742	N	N	N	N
vg1216580086	G -> T	LOC_Os12g28080.1	downstream_gene_variant ; 858.0bp to feature; MODIFIER	silent_mutation	Average:18.63; most accessible tissue: Zhenshan97 root, score: 39.742	N	N	N	N
vg1216580086	G -> T	LOC_Os12g28070-LOC_Os12g28080	intergenic_region ; MODIFIER	silent_mutation	Average:18.63; most accessible tissue: Zhenshan97 root, score: 39.742	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216580086	NA	6.31E-07	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086	NA	6.40E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086	NA	2.45E-12	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086	NA	4.66E-07	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086	NA	3.24E-07	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086	NA	1.67E-06	mr1129_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086	5.11E-06	2.18E-15	mr1162_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086	6.29E-07	6.29E-07	mr1162_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086	NA	1.53E-06	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086	3.85E-06	NA	mr1613_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086	NA	1.72E-07	mr1629_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086	5.41E-06	5.41E-06	mr1754_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086	NA	1.13E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086	NA	1.70E-08	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251