\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216580086:

Variant ID: vg1216580086 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16580086
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTAGACATATATATGTGTTTAGATTCATTAATATCTATATGGATATGAGCAATACTAGAAAGTCTTACATCGTGAAACAGAGGAAGTAATATCATAAAC[G/T]
TATTTAACTTTAGAAATTTAATTTAATCAACTCTTGTCTTTAACATCGAAAGGAGAGTGATTCTTCTTCCTTTTAATAATAGAAACTGGCACGCTCTTGT

Reverse complement sequence

ACAAGAGCGTGCCAGTTTCTATTATTAAAAGGAAGAAGAATCACTCTCCTTTCGATGTTAAAGACAAGAGTTGATTAAATTAAATTTCTAAAGTTAAATA[C/A]
GTTTATGATATTACTTCCTCTGTTTCACGATGTAAGACTTTCTAGTATTGCTCATATCCATATAGATATTAATGAATCTAAACACATATATATGTCTAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 17.40% 0.34% 22.53% NA
All Indica  2759 70.00% 2.20% 0.47% 27.29% NA
All Japonica  1512 33.90% 48.70% 0.00% 17.39% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 86.90% 2.00% 0.17% 10.92% NA
Indica II  465 69.00% 2.40% 0.22% 28.39% NA
Indica III  913 53.80% 0.40% 0.99% 44.80% NA
Indica Intermediate  786 76.60% 4.50% 0.25% 18.70% NA
Temperate Japonica  767 19.80% 79.80% 0.00% 0.39% NA
Tropical Japonica  504 47.60% 4.20% 0.00% 48.21% NA
Japonica Intermediate  241 49.80% 43.20% 0.00% 7.05% NA
VI/Aromatic  96 74.00% 1.00% 1.04% 23.96% NA
Intermediate  90 48.90% 22.20% 2.22% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216580086 G -> DEL N N silent_mutation Average:18.63; most accessible tissue: Zhenshan97 root, score: 39.742 N N N N
vg1216580086 G -> T LOC_Os12g28070.1 upstream_gene_variant ; 1881.0bp to feature; MODIFIER silent_mutation Average:18.63; most accessible tissue: Zhenshan97 root, score: 39.742 N N N N
vg1216580086 G -> T LOC_Os12g28090.1 upstream_gene_variant ; 2568.0bp to feature; MODIFIER silent_mutation Average:18.63; most accessible tissue: Zhenshan97 root, score: 39.742 N N N N
vg1216580086 G -> T LOC_Os12g28080.1 downstream_gene_variant ; 858.0bp to feature; MODIFIER silent_mutation Average:18.63; most accessible tissue: Zhenshan97 root, score: 39.742 N N N N
vg1216580086 G -> T LOC_Os12g28070-LOC_Os12g28080 intergenic_region ; MODIFIER silent_mutation Average:18.63; most accessible tissue: Zhenshan97 root, score: 39.742 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216580086 NA 6.31E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086 NA 6.40E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086 NA 2.45E-12 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086 NA 4.66E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086 NA 3.24E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086 NA 1.67E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086 5.11E-06 2.18E-15 mr1162_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086 6.29E-07 6.29E-07 mr1162_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086 NA 1.53E-06 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086 3.85E-06 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086 NA 1.72E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086 5.41E-06 5.41E-06 mr1754_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086 NA 1.13E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216580086 NA 1.70E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251