Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216564044:

Variant ID: vg1216564044 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16564044
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCGGACCTCGTCGGCGGGGGGGGGGGGGGGGGGGTAGGCCCGAAGGCAGCCGCCAAGCCGACGCTTCCCGACCCCGGTGAGGGACGGTGGAGAGACGAG[G/C]
TCCAAGGCGGCGCGCACACGGCGGTCAACCGGCGCGACCTCGAGGAGTCCGGAGAGCTCCGGCAAGCTTAGGGGGTCTAAATCCAGTAATTAACCCGAAC

Reverse complement sequence

GTTCGGGTTAATTACTGGATTTAGACCCCCTAAGCTTGCCGGAGCTCTCCGGACTCCTCGAGGTCGCGCCGGTTGACCGCCGTGTGCGCGCCGCCTTGGA[C/G]
CTCGTCTCTCCACCGTCCCTCACCGGGGTCGGGAAGCGTCGGCTTGGCGGCTGCCTTCGGGCCTACCCCCCCCCCCCCCCCCCCGCCGACGAGGTCCGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.90%	17.30%	4.95%	5.90%	NA
All Indica	2759	86.10%	2.20%	7.90%	3.84%	NA
All Japonica	1512	49.00%	48.50%	0.53%	1.92%	NA
Aus	269	48.70%	0.40%	0.00%	50.93%	NA
Indica I	595	70.60%	2.50%	25.38%	1.51%	NA
Indica II	465	93.10%	2.40%	2.37%	2.15%	NA
Indica III	913	95.40%	0.10%	0.99%	3.50%	NA
Indica Intermediate	786	82.80%	4.20%	5.98%	7.00%	NA
Temperate Japonica	767	20.20%	79.80%	0.00%	0.00%	NA
Tropical Japonica	504	90.10%	3.80%	1.59%	4.56%	NA
Japonica Intermediate	241	54.80%	42.70%	0.00%	2.49%	NA
VI/Aromatic	96	93.80%	0.00%	3.12%	3.12%	NA
Intermediate	90	65.60%	24.40%	5.56%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216564044	G -> C	LOC_Os12g28065.1	downstream_gene_variant ; 983.0bp to feature; MODIFIER	silent_mutation	Average:54.28; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg1216564044	G -> C	LOC_Os12g28050-LOC_Os12g28065	intergenic_region ; MODIFIER	silent_mutation	Average:54.28; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg1216564044	G -> DEL	N	N	silent_mutation	Average:54.28; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216564044	NA	2.86E-30	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	1.26E-12	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	1.05E-06	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	4.88E-06	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	7.61E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	8.33E-17	mr1308	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	7.84E-07	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	3.79E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	6.94E-09	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	7.22E-07	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	8.26E-08	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	4.86E-07	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	1.36E-06	mr1129_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	3.09E-06	1.03E-16	mr1162_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	5.60E-07	5.60E-07	mr1162_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	7.28E-07	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	1.28E-06	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	1.64E-17	mr1539_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	1.71E-16	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	4.28E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	5.41E-08	NA	mr1613_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	1.03E-07	mr1629_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	1.09E-07	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	1.30E-07	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	3.35E-06	3.35E-06	mr1754_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	NA	5.60E-09	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216564044	2.53E-06	1.99E-09	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251