\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216560726:

Variant ID: vg1216560726 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16560726
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.18, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GATTTTAGCTTTAGTGTCTTAAATTTCTTAAAGGAAATCGGAGGTCGCTAATGGGTAAACATAGCCATAAAAAATCATTTGTTGGCTAATATCTTAACTT[T/C,A]
GTGAAATTTACACTTAAAGCTAAACAACGCCATTAAAATTTAAGGGAAAGAATATCTCTATCTCATGAGACGTTTCAAACTCCCCTAGGTATGTGACATA

Reverse complement sequence

TATGTCACATACCTAGGGGAGTTTGAAACGTCTCATGAGATAGAGATATTCTTTCCCTTAAATTTTAATGGCGTTGTTTAGCTTTAAGTGTAAATTTCAC[A/G,T]
AAGTTAAGATATTAGCCAACAAATGATTTTTTATGGCTATGTTTACCCATTAGCGACCTCCGATTTCCTTTAAGAAATTTAAGACACTAAAGCTAAAATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.50% 38.70% 4.40% 2.37% A: 0.08%
All Indica  2759 62.10% 34.30% 2.94% 0.65% NA
All Japonica  1512 42.00% 53.70% 2.91% 1.32% A: 0.07%
Aus  269 34.90% 9.30% 27.88% 26.77% A: 1.12%
Indica I  595 80.80% 19.00% 0.17% 0.00% NA
Indica II  465 44.50% 54.40% 0.86% 0.22% NA
Indica III  913 69.00% 27.40% 3.07% 0.55% NA
Indica Intermediate  786 50.40% 42.00% 6.11% 1.53% NA
Temperate Japonica  767 18.40% 79.40% 1.96% 0.13% A: 0.13%
Tropical Japonica  504 76.20% 16.30% 4.17% 3.37% NA
Japonica Intermediate  241 45.60% 50.20% 3.32% 0.83% NA
VI/Aromatic  96 87.50% 9.40% 2.08% 1.04% NA
Intermediate  90 53.30% 38.90% 6.67% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216560726 T -> C LOC_Os12g28065.1 downstream_gene_variant ; 4301.0bp to feature; MODIFIER silent_mutation Average:17.389; most accessible tissue: Callus, score: 36.027 N N N N
vg1216560726 T -> C LOC_Os12g28050-LOC_Os12g28065 intergenic_region ; MODIFIER silent_mutation Average:17.389; most accessible tissue: Callus, score: 36.027 N N N N
vg1216560726 T -> DEL N N silent_mutation Average:17.389; most accessible tissue: Callus, score: 36.027 N N N N
vg1216560726 T -> A LOC_Os12g28065.1 downstream_gene_variant ; 4301.0bp to feature; MODIFIER silent_mutation Average:17.389; most accessible tissue: Callus, score: 36.027 N N N N
vg1216560726 T -> A LOC_Os12g28050-LOC_Os12g28065 intergenic_region ; MODIFIER silent_mutation Average:17.389; most accessible tissue: Callus, score: 36.027 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216560726 NA 2.20E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216560726 NA 2.22E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216560726 NA 3.95E-12 mr1866 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216560726 NA 3.80E-07 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216560726 NA 5.86E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216560726 NA 3.01E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216560726 NA 2.74E-11 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216560726 NA 2.77E-06 mr1219_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216560726 NA 4.92E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216560726 NA 3.38E-06 mr1466_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216560726 NA 5.94E-07 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216560726 NA 1.40E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216560726 NA 1.17E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216560726 NA 9.14E-07 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251