\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216557565:

Variant ID: vg1216557565 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16557565
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGAAGGCCCAGCGCCGGCGAGCATGCGTGCGGACCACGTTCTTTTTTTTTGCTTTCTTTTTTGCCATGATTTTTTTCCTTTCCTTTTTTCACTTTTTTC[G/A]
ATTACTTTTTAAATATTTATTTCGCTTTCTTTTTTCTGTGATTTTTTCGCTTTCCTTTTTTTTCCGCTTTTTTCTGATTACTTTTTTAATCTTCCAACAA

Reverse complement sequence

TTGTTGGAAGATTAAAAAAGTAATCAGAAAAAAGCGGAAAAAAAAGGAAAGCGAAAAAATCACAGAAAAAAGAAAGCGAAATAAATATTTAAAAAGTAAT[C/T]
GAAAAAAGTGAAAAAAGGAAAGGAAAAAAATCATGGCAAAAAAGAAAGCAAAAAAAAAGAACGTGGTCCGCACGCATGCTCGCCGGCGCTGGGCCTTCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.20% 9.20% 0.93% 2.67% NA
All Indica  2759 93.50% 6.10% 0.14% 0.29% NA
All Japonica  1512 91.50% 6.20% 1.26% 1.06% NA
Aus  269 16.70% 38.30% 7.81% 37.17% NA
Indica I  595 92.30% 7.70% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 91.60% 8.30% 0.00% 0.11% NA
Indica Intermediate  786 94.50% 4.10% 0.51% 0.89% NA
Temperate Japonica  767 95.40% 2.30% 0.78% 1.43% NA
Tropical Japonica  504 86.10% 11.10% 2.38% 0.40% NA
Japonica Intermediate  241 90.50% 7.90% 0.41% 1.24% NA
VI/Aromatic  96 33.30% 65.60% 0.00% 1.04% NA
Intermediate  90 86.70% 12.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216557565 G -> DEL N N silent_mutation Average:32.242; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1216557565 G -> A LOC_Os12g28050-LOC_Os12g28065 intergenic_region ; MODIFIER silent_mutation Average:32.242; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216557565 NA 1.06E-09 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216557565 NA 1.14E-11 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216557565 NA 3.60E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216557565 NA 3.23E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216557565 NA 2.29E-11 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216557565 NA 2.34E-13 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216557565 NA 4.48E-14 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216557565 NA 2.54E-07 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216557565 NA 5.32E-08 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216557565 NA 1.31E-10 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216557565 NA 3.88E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216557565 5.68E-06 4.67E-14 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216557565 NA 2.61E-15 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216557565 2.87E-06 2.27E-15 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216557565 1.07E-07 NA mr1261_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216557565 NA 2.07E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216557565 1.01E-07 1.23E-17 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216557565 2.63E-07 1.45E-17 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251