Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216556661:

Variant ID: vg1216556661 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16556661
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCCACATCCATGTCTCACGGGGGTCGCTGTCGCTAGAGGAACTGCACGGCATCACGCATTAGACGAAGTCTCGGTTGGCGGCTCGAAGACAAAGACGTC[G/A]
AAAAGGAGCACACCGGTTCAGTTGTTGTACTTCACGGCCTTGAGGAGGTAAGCGTGGACGCCCTCGCTATTGCCAACACCCTCCTTGCCGCCAGATCCAT

Reverse complement sequence

ATGGATCTGGCGGCAAGGAGGGTGTTGGCAATAGCGAGGGCGTCCACGCTTACCTCCTCAAGGCCGTGAAGTACAACAACTGAACCGGTGTGCTCCTTTT[C/T]
GACGTCTTTGTCTTCGAGCCGCCAACCGAGACTTCGTCTAATGCGTGATGCCGTGCAGTTCCTCTAGCGACAGCGACCCCCGTGAGACATGGATGTGGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.70%	0.70%	2.09%	2.48%	NA
All Indica	2759	97.00%	0.00%	0.83%	2.14%	NA
All Japonica	1512	97.40%	2.10%	0.53%	0.00%	NA
Aus	269	54.30%	0.00%	24.91%	20.82%	NA
Indica I	595	99.80%	0.00%	0.00%	0.17%	NA
Indica II	465	99.60%	0.00%	0.00%	0.43%	NA
Indica III	913	96.70%	0.00%	0.44%	2.85%	NA
Indica Intermediate	786	93.60%	0.10%	2.42%	3.82%	NA
Temperate Japonica	767	95.80%	3.30%	0.91%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.10%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	96.70%	1.10%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216556661	G -> DEL	N	N	silent_mutation	Average:67.363; most accessible tissue: Zhenshan97 young leaf, score: 89.339	N	N	N	N
vg1216556661	G -> A	LOC_Os12g28050-LOC_Os12g28065	intergenic_region ; MODIFIER	silent_mutation	Average:67.363; most accessible tissue: Zhenshan97 young leaf, score: 89.339	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216556661	NA	2.76E-06	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216556661	NA	4.01E-07	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216556661	5.20E-06	8.58E-08	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216556661	5.51E-06	3.94E-07	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216556661	3.32E-06	4.22E-08	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216556661	1.49E-07	8.94E-10	mr1113_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216556661	8.19E-07	9.79E-08	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216556661	NA	1.98E-06	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216556661	NA	9.49E-06	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216556661	9.96E-06	3.66E-07	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216556661	NA	4.15E-06	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216556661	NA	1.58E-06	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251