\
| Variant ID: vg1216555105 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16555105 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCTCCCTCCTCCCCCCCTTGGGCTAGATCTGGGAGAGAGGGGAGGGGAGCCGCGCCGACCCTGTCGCCTCGCCGTTGCCGCCGTTGACCCCGCCGCCTCC[A/G]
CGCCTCGCCATTGCCAACCCCGCCGCCTCCCATCGCCATGCTGAGGGAGCTAAGGGAGAGGAGTGGTGAGGCCTGAGGGAGAGGAGAGCTGTGAGCCTGT
ACAGGCTCACAGCTCTCCTCTCCCTCAGGCCTCACCACTCCTCTCCCTTAGCTCCCTCAGCATGGCGATGGGAGGCGGCGGGGTTGGCAATGGCGAGGCG[T/C]
GGAGGCGGCGGGGTCAACGGCGGCAACGGCGAGGCGACAGGGTCGGCGCGGCTCCCCTCCCCTCTCTCCCAGATCTAGCCCAAGGGGGGGAGGAGGGAGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.10% | 19.10% | 3.20% | 4.57% | NA |
| All Indica | 2759 | 86.90% | 5.10% | 5.18% | 2.75% | NA |
| All Japonica | 1512 | 51.10% | 48.70% | 0.20% | 0.07% | NA |
| Aus | 269 | 48.30% | 0.70% | 0.37% | 50.56% | NA |
| Indica I | 595 | 90.10% | 2.00% | 6.89% | 1.01% | NA |
| Indica II | 465 | 95.30% | 3.70% | 0.43% | 0.65% | NA |
| Indica III | 913 | 83.10% | 6.70% | 5.91% | 4.27% | NA |
| Indica Intermediate | 786 | 84.00% | 6.60% | 5.85% | 3.56% | NA |
| Temperate Japonica | 767 | 19.60% | 80.10% | 0.26% | 0.13% | NA |
| Tropical Japonica | 504 | 95.80% | 4.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 57.70% | 42.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 70.00% | 24.40% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216555105 | A -> DEL | N | N | silent_mutation | Average:73.512; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg1216555105 | A -> G | LOC_Os12g28050-LOC_Os12g28065 | intergenic_region ; MODIFIER | silent_mutation | Average:73.512; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216555105 | NA | 6.25E-06 | mr1271 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | NA | 1.73E-15 | mr1401 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | NA | 3.82E-07 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | NA | 6.18E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | NA | 7.59E-07 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | 1.99E-08 | NA | mr1071_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | 4.77E-06 | NA | mr1080_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | NA | 1.27E-09 | mr1089_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | NA | 7.43E-07 | mr1129_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | 1.71E-06 | 1.71E-06 | mr1162_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | NA | 6.77E-13 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | 8.22E-08 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | NA | 2.64E-07 | mr1257_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | NA | 4.61E-10 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | 6.03E-10 | NA | mr1613_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | NA | 1.33E-07 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | NA | 1.32E-06 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | 1.17E-06 | 1.17E-06 | mr1754_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | NA | 4.88E-09 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216555105 | NA | 2.62E-07 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |