\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216550268:

Variant ID: vg1216550268 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 16550268
Reference Allele: GCGCTCCTAATAlternative Allele: ACGCTCCTAAT,G
Primary Allele: GCGCTCCTAATSecondary Allele: ACGCTCCTAAT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTAAATCGTTTACTCCGACAACGGTAAGAGTGGATTGACGGGATGTGGGGTGGGGTGGGCTTGGGCTGATGCATGTTTGGCGCTTGAAATATTAGGAGC[GCGCTCCTAAT/ACGCTCCTAAT,G]
AGTAGTTCTAGTAAATATATTCAGTTATTGATTTGATGGCACTAATTTATAGTATTATAAATATTATTATATTTGTCTATAAACTTAGTCAAATTTGAAA

Reverse complement sequence

TTTCAAATTTGACTAAGTTTATAGACAAATATAATAATATTTATAATACTATAAATTAGTGCCATCAAATCAATAACTGAATATATTTACTAGAACTACT[ATTAGGAGCGC/ATTAGGAGCGT,C]
GCTCCTAATATTTCAAGCGCCAAACATGCATCAGCCCAAGCCCACCCCACCCCACATCCCGTCAATCCACTCTTACCGTTGTCGGAGTAAACGATTTACT

Allele Frequencies:

Populations Population SizeFrequency of GCGCTCCTAAT(primary allele) Frequency of ACGCTCCTAAT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 36.80% 0.11% 3.32% G: 3.53%
All Indica  2759 41.60% 56.70% 0.11% 0.83% G: 0.76%
All Japonica  1512 92.50% 7.30% 0.07% 0.00% G: 0.20%
Aus  269 10.00% 9.70% 0.00% 49.44% G: 30.86%
Indica I  595 65.00% 35.00% 0.00% 0.00% NA
Indica II  465 45.80% 53.10% 0.00% 0.00% G: 1.08%
Indica III  913 22.90% 75.50% 0.11% 0.66% G: 0.88%
Indica Intermediate  786 43.00% 53.60% 0.25% 2.16% G: 1.02%
Temperate Japonica  767 96.60% 3.40% 0.00% 0.00% NA
Tropical Japonica  504 87.30% 12.50% 0.20% 0.00% NA
Japonica Intermediate  241 90.00% 8.70% 0.00% 0.00% G: 1.24%
VI/Aromatic  96 27.10% 14.60% 0.00% 1.04% G: 57.29%
Intermediate  90 68.90% 24.40% 1.11% 0.00% G: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216550268 GCGCTCCTAAT -> DEL N N silent_mutation Average:38.577; most accessible tissue: Zhenshan97 young leaf, score: 52.657 N N N N
vg1216550268 GCGCTCCTAAT -> G LOC_Os12g28050-LOC_Os12g28065 intergenic_region ; MODIFIER silent_mutation Average:38.577; most accessible tissue: Zhenshan97 young leaf, score: 52.657 N N N N
vg1216550268 GCGCTCCTAAT -> ACGCTCCTAAT LOC_Os12g28050-LOC_Os12g28065 intergenic_region ; MODIFIER silent_mutation Average:38.577; most accessible tissue: Zhenshan97 young leaf, score: 52.657 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216550268 NA 1.25E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 NA 2.21E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 NA 2.53E-11 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 NA 2.88E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 NA 7.42E-11 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 NA 4.12E-09 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 NA 5.58E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 NA 1.08E-12 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 NA 1.04E-13 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 NA 6.30E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 NA 5.21E-10 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 4.79E-06 NA mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 NA 1.23E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 3.66E-06 NA mr1079_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 2.61E-06 NA mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 6.07E-06 NA mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 NA 6.79E-16 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 5.85E-06 1.43E-16 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 1.60E-06 3.70E-17 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 2.04E-06 NA mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 4.51E-07 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 3.16E-06 NA mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216550268 9.10E-06 7.09E-17 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251