\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216543392:

Variant ID: vg1216543392 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16543392
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATATTAAGATCTCGAATGTGTCTTTTGCTGTAACAAAATTTTTGTGCTGTTGTTTTTGTATATATGTGGTTCCTCTTTAATAGTTTTCAGAACAATAT[A/T]
TATTTGCCAGAAAACCTGAAACTTGAAGAAAAACATTGGAACATTTTGCTCAAGCTTTTGTCATATAATGTTGGGAACTACAAAAAAAATTTCATAAATT

Reverse complement sequence

AATTTATGAAATTTTTTTTGTAGTTCCCAACATTATATGACAAAAGCTTGAGCAAAATGTTCCAATGTTTTTCTTCAAGTTTCAGGTTTTCTGGCAAATA[T/A]
ATATTGTTCTGAAAACTATTAAAGAGGAACCACATATATACAAAAACAACAGCACAAAAATTTTGTTACAGCAAAAGACACATTCGAGATCTTAATATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.10% 31.50% 0.32% 0.11% NA
All Indica  2759 57.10% 42.20% 0.54% 0.18% NA
All Japonica  1512 81.90% 18.10% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 36.80% 62.20% 1.01% 0.00% NA
Indica II  465 39.40% 60.20% 0.43% 0.00% NA
Indica III  913 80.80% 18.70% 0.11% 0.33% NA
Indica Intermediate  786 55.30% 43.60% 0.76% 0.25% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 51.00% 49.00% 0.00% 0.00% NA
Japonica Intermediate  241 92.10% 7.90% 0.00% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216543392 A -> DEL N N silent_mutation Average:18.026; most accessible tissue: Zhenshan97 young leaf, score: 25.214 N N N N
vg1216543392 A -> T LOC_Os12g28040.1 upstream_gene_variant ; 3520.0bp to feature; MODIFIER silent_mutation Average:18.026; most accessible tissue: Zhenshan97 young leaf, score: 25.214 N N N N
vg1216543392 A -> T LOC_Os12g28050.1 downstream_gene_variant ; 50.0bp to feature; MODIFIER silent_mutation Average:18.026; most accessible tissue: Zhenshan97 young leaf, score: 25.214 N N N N
vg1216543392 A -> T LOC_Os12g28040-LOC_Os12g28050 intergenic_region ; MODIFIER silent_mutation Average:18.026; most accessible tissue: Zhenshan97 young leaf, score: 25.214 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216543392 NA 1.53E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392 NA 8.94E-08 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392 NA 6.97E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392 NA 1.44E-09 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392 NA 7.76E-10 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392 NA 3.14E-08 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392 9.66E-07 NA mr1458_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392 1.51E-07 1.09E-09 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392 NA 2.43E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392 NA 6.18E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392 NA 3.19E-06 mr1782_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392 NA 1.08E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392 NA 3.77E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392 NA 1.24E-11 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251