Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1216543392:

Variant ID: vg1216543392 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16543392
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATATTAAGATCTCGAATGTGTCTTTTGCTGTAACAAAATTTTTGTGCTGTTGTTTTTGTATATATGTGGTTCCTCTTTAATAGTTTTCAGAACAATAT[A/T]
TATTTGCCAGAAAACCTGAAACTTGAAGAAAAACATTGGAACATTTTGCTCAAGCTTTTGTCATATAATGTTGGGAACTACAAAAAAAATTTCATAAATT

Reverse complement sequence

AATTTATGAAATTTTTTTTGTAGTTCCCAACATTATATGACAAAAGCTTGAGCAAAATGTTCCAATGTTTTTCTTCAAGTTTCAGGTTTTCTGGCAAATA[T/A]
ATATTGTTCTGAAAACTATTAAAGAGGAACCACATATATACAAAAACAACAGCACAAAAATTTTGTTACAGCAAAAGACACATTCGAGATCTTAATATTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.10%	31.50%	0.32%	0.11%	NA
All Indica	2759	57.10%	42.20%	0.54%	0.18%	NA
All Japonica	1512	81.90%	18.10%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	36.80%	62.20%	1.01%	0.00%	NA
Indica II	465	39.40%	60.20%	0.43%	0.00%	NA
Indica III	913	80.80%	18.70%	0.11%	0.33%	NA
Indica Intermediate	786	55.30%	43.60%	0.76%	0.25%	NA
Temperate Japonica	767	99.00%	1.00%	0.00%	0.00%	NA
Tropical Japonica	504	51.00%	49.00%	0.00%	0.00%	NA
Japonica Intermediate	241	92.10%	7.90%	0.00%	0.00%	NA
VI/Aromatic	96	76.00%	24.00%	0.00%	0.00%	NA
Intermediate	90	72.20%	27.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216543392	A -> DEL	N	N	silent_mutation	Average:18.026; most accessible tissue: Zhenshan97 young leaf, score: 25.214	N	N	N	N
vg1216543392	A -> T	LOC_Os12g28040.1	upstream_gene_variant ; 3520.0bp to feature; MODIFIER	silent_mutation	Average:18.026; most accessible tissue: Zhenshan97 young leaf, score: 25.214	N	N	N	N
vg1216543392	A -> T	LOC_Os12g28050.1	downstream_gene_variant ; 50.0bp to feature; MODIFIER	silent_mutation	Average:18.026; most accessible tissue: Zhenshan97 young leaf, score: 25.214	N	N	N	N
vg1216543392	A -> T	LOC_Os12g28040-LOC_Os12g28050	intergenic_region ; MODIFIER	silent_mutation	Average:18.026; most accessible tissue: Zhenshan97 young leaf, score: 25.214	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216543392	NA	1.53E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392	NA	8.94E-08	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392	NA	6.97E-08	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392	NA	1.44E-09	mr1089_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392	NA	7.76E-10	mr1093_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392	NA	3.14E-08	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392	9.66E-07	NA	mr1458_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392	1.51E-07	1.09E-09	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392	NA	2.43E-09	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392	NA	6.18E-06	mr1686_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392	NA	3.19E-06	mr1782_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392	NA	1.08E-07	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392	NA	3.77E-06	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216543392	NA	1.24E-11	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251