\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216542145:

Variant ID: vg1216542145 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16542145
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGCTCTGAATTTCTTGGTCATAATTTTTCCTCCTAGAAGAAGGGATTCAAGTTGAATGCTAGTAAACTGAATCCGGAGCAAGTGAGCTTGTTCAGAAT[A/G]
GCTGAGCTTGACAAGGTGGACAAGCTAATGATCACTACGTCAATCAACGCTTGAGAGATTCCTGGTGTGTTATGTCCTGTAATTCCTGTGAATCCATTAT

Reverse complement sequence

ATAATGGATTCACAGGAATTACAGGACATAACACACCAGGAATCTCTCAAGCGTTGATTGACGTAGTGATCATTAGCTTGTCCACCTTGTCAAGCTCAGC[T/C]
ATTCTGAACAAGCTCACTTGCTCCGGATTCAGTTTACTAGCATTCAACTTGAATCCCTTCTTCTAGGAGGAAAAATTATGACCAAGAAATTCAGAGCTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.70% 27.30% 1.42% 37.56% NA
All Indica  2759 47.30% 2.70% 2.17% 47.81% NA
All Japonica  1512 5.00% 76.80% 0.13% 18.06% NA
Aus  269 40.90% 7.80% 0.37% 50.93% NA
Indica I  595 35.00% 1.80% 4.20% 58.99% NA
Indica II  465 18.50% 3.40% 2.37% 75.70% NA
Indica III  913 76.90% 0.80% 0.55% 21.80% NA
Indica Intermediate  786 39.40% 5.10% 2.42% 53.05% NA
Temperate Japonica  767 0.80% 98.20% 0.00% 1.04% NA
Tropical Japonica  504 10.50% 40.50% 0.20% 48.81% NA
Japonica Intermediate  241 7.10% 84.60% 0.41% 7.88% NA
VI/Aromatic  96 80.20% 0.00% 2.08% 17.71% NA
Intermediate  90 27.80% 37.80% 2.22% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216542145 A -> DEL N N silent_mutation Average:7.092; most accessible tissue: Callus, score: 27.545 N N N N
vg1216542145 A -> G LOC_Os12g28040.1 upstream_gene_variant ; 2273.0bp to feature; MODIFIER silent_mutation Average:7.092; most accessible tissue: Callus, score: 27.545 N N N N
vg1216542145 A -> G LOC_Os12g28050.1 downstream_gene_variant ; 1297.0bp to feature; MODIFIER silent_mutation Average:7.092; most accessible tissue: Callus, score: 27.545 N N N N
vg1216542145 A -> G LOC_Os12g28040-LOC_Os12g28050 intergenic_region ; MODIFIER silent_mutation Average:7.092; most accessible tissue: Callus, score: 27.545 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216542145 NA 3.64E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1216542145 4.46E-07 NA mr1016 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 9.73E-07 NA mr1017 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 7.62E-07 NA mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 NA 2.29E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 8.04E-07 NA mr1142 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 NA 7.21E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 NA 7.75E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 NA 1.23E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 NA 3.67E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 NA 1.64E-20 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 NA 5.04E-09 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 NA 9.83E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 NA 5.48E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 NA 3.40E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 NA 9.05E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 NA 1.36E-15 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 NA 4.19E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 NA 7.31E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 NA 1.60E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 NA 1.29E-06 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542145 NA 2.55E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251