Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216541381:

Variant ID: vg1216541381 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16541381
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCAAAGGTTCATATCTATTTCTACTACCACCACATTTAGTGGTAGTAGAATTGTGGAGGGCTACTTTGTCCAGGAAAAATTATCTGCGGAGGGATATTTT[C/T]
GTCCTTTACCCTGAATCGCGCATCTGGAGCCGATGCGGAGAGAACCCCGCGGCTCCCATCACCGCCTTGACGACCTCGCCTGCTCCACCGCCCTCGACGC

Reverse complement sequence

GCGTCGAGGGCGGTGGAGCAGGCGAGGTCGTCAAGGCGGTGATGGGAGCCGCGGGGTTCTCTCCGCATCGGCTCCAGATGCGCGATTCAGGGTAAAGGAC[G/A]
AAAATATCCCTCCGCAGATAATTTTTCCTGGACAAAGTAGCCCTCCACAATTCTACTACCACTAAATGTGGTGGTAGTAGAAATAGATATGAACCTTTGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.40%	3.00%	0.91%	32.65%	NA
All Indica	2759	49.50%	3.70%	1.52%	45.31%	NA
All Japonica	1512	80.80%	2.60%	0.07%	16.53%	NA
Aus	269	92.90%	0.40%	0.00%	6.69%	NA
Indica I	595	23.20%	15.00%	2.18%	59.66%	NA
Indica II	465	27.70%	0.20%	1.08%	70.97%	NA
Indica III	913	78.80%	0.20%	0.33%	20.70%	NA
Indica Intermediate	786	48.20%	1.30%	2.67%	47.84%	NA
Temperate Japonica	767	95.20%	4.20%	0.00%	0.65%	NA
Tropical Japonica	504	54.20%	0.20%	0.20%	45.44%	NA
Japonica Intermediate	241	90.90%	2.50%	0.00%	6.64%	NA
VI/Aromatic	96	95.80%	0.00%	0.00%	4.17%	NA
Intermediate	90	75.60%	1.10%	0.00%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216541381	C -> DEL	N	N	silent_mutation	Average:11.15; most accessible tissue: Callus, score: 30.903	N	N	N	N
vg1216541381	C -> T	LOC_Os12g28040.1	upstream_gene_variant ; 1509.0bp to feature; MODIFIER	silent_mutation	Average:11.15; most accessible tissue: Callus, score: 30.903	N	N	N	N
vg1216541381	C -> T	LOC_Os12g28050.1	downstream_gene_variant ; 2061.0bp to feature; MODIFIER	silent_mutation	Average:11.15; most accessible tissue: Callus, score: 30.903	N	N	N	N
vg1216541381	C -> T	LOC_Os12g28040-LOC_Os12g28050	intergenic_region ; MODIFIER	silent_mutation	Average:11.15; most accessible tissue: Callus, score: 30.903	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216541381	NA	4.23E-06	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216541381	NA	3.36E-06	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216541381	NA	1.36E-06	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216541381	NA	3.22E-06	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216541381	NA	2.67E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216541381	2.28E-06	2.88E-08	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216541381	6.94E-06	1.02E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216541381	NA	2.50E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216541381	4.89E-08	NA	mr1695_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216541381	3.53E-06	NA	mr1695_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251