\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216541381:

Variant ID: vg1216541381 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16541381
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAAAGGTTCATATCTATTTCTACTACCACCACATTTAGTGGTAGTAGAATTGTGGAGGGCTACTTTGTCCAGGAAAAATTATCTGCGGAGGGATATTTT[C/T]
GTCCTTTACCCTGAATCGCGCATCTGGAGCCGATGCGGAGAGAACCCCGCGGCTCCCATCACCGCCTTGACGACCTCGCCTGCTCCACCGCCCTCGACGC

Reverse complement sequence

GCGTCGAGGGCGGTGGAGCAGGCGAGGTCGTCAAGGCGGTGATGGGAGCCGCGGGGTTCTCTCCGCATCGGCTCCAGATGCGCGATTCAGGGTAAAGGAC[G/A]
AAAATATCCCTCCGCAGATAATTTTTCCTGGACAAAGTAGCCCTCCACAATTCTACTACCACTAAATGTGGTGGTAGTAGAAATAGATATGAACCTTTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 3.00% 0.91% 32.65% NA
All Indica  2759 49.50% 3.70% 1.52% 45.31% NA
All Japonica  1512 80.80% 2.60% 0.07% 16.53% NA
Aus  269 92.90% 0.40% 0.00% 6.69% NA
Indica I  595 23.20% 15.00% 2.18% 59.66% NA
Indica II  465 27.70% 0.20% 1.08% 70.97% NA
Indica III  913 78.80% 0.20% 0.33% 20.70% NA
Indica Intermediate  786 48.20% 1.30% 2.67% 47.84% NA
Temperate Japonica  767 95.20% 4.20% 0.00% 0.65% NA
Tropical Japonica  504 54.20% 0.20% 0.20% 45.44% NA
Japonica Intermediate  241 90.90% 2.50% 0.00% 6.64% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 75.60% 1.10% 0.00% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216541381 C -> DEL N N silent_mutation Average:11.15; most accessible tissue: Callus, score: 30.903 N N N N
vg1216541381 C -> T LOC_Os12g28040.1 upstream_gene_variant ; 1509.0bp to feature; MODIFIER silent_mutation Average:11.15; most accessible tissue: Callus, score: 30.903 N N N N
vg1216541381 C -> T LOC_Os12g28050.1 downstream_gene_variant ; 2061.0bp to feature; MODIFIER silent_mutation Average:11.15; most accessible tissue: Callus, score: 30.903 N N N N
vg1216541381 C -> T LOC_Os12g28040-LOC_Os12g28050 intergenic_region ; MODIFIER silent_mutation Average:11.15; most accessible tissue: Callus, score: 30.903 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216541381 NA 4.23E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216541381 NA 3.36E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216541381 NA 1.36E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216541381 NA 3.22E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216541381 NA 2.67E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216541381 2.28E-06 2.88E-08 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216541381 6.94E-06 1.02E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216541381 NA 2.50E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216541381 4.89E-08 NA mr1695_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216541381 3.53E-06 NA mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251