\
| Variant ID: vg1216541381 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16541381 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCAAAGGTTCATATCTATTTCTACTACCACCACATTTAGTGGTAGTAGAATTGTGGAGGGCTACTTTGTCCAGGAAAAATTATCTGCGGAGGGATATTTT[C/T]
GTCCTTTACCCTGAATCGCGCATCTGGAGCCGATGCGGAGAGAACCCCGCGGCTCCCATCACCGCCTTGACGACCTCGCCTGCTCCACCGCCCTCGACGC
GCGTCGAGGGCGGTGGAGCAGGCGAGGTCGTCAAGGCGGTGATGGGAGCCGCGGGGTTCTCTCCGCATCGGCTCCAGATGCGCGATTCAGGGTAAAGGAC[G/A]
AAAATATCCCTCCGCAGATAATTTTTCCTGGACAAAGTAGCCCTCCACAATTCTACTACCACTAAATGTGGTGGTAGTAGAAATAGATATGAACCTTTGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.40% | 3.00% | 0.91% | 32.65% | NA |
| All Indica | 2759 | 49.50% | 3.70% | 1.52% | 45.31% | NA |
| All Japonica | 1512 | 80.80% | 2.60% | 0.07% | 16.53% | NA |
| Aus | 269 | 92.90% | 0.40% | 0.00% | 6.69% | NA |
| Indica I | 595 | 23.20% | 15.00% | 2.18% | 59.66% | NA |
| Indica II | 465 | 27.70% | 0.20% | 1.08% | 70.97% | NA |
| Indica III | 913 | 78.80% | 0.20% | 0.33% | 20.70% | NA |
| Indica Intermediate | 786 | 48.20% | 1.30% | 2.67% | 47.84% | NA |
| Temperate Japonica | 767 | 95.20% | 4.20% | 0.00% | 0.65% | NA |
| Tropical Japonica | 504 | 54.20% | 0.20% | 0.20% | 45.44% | NA |
| Japonica Intermediate | 241 | 90.90% | 2.50% | 0.00% | 6.64% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 75.60% | 1.10% | 0.00% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216541381 | C -> DEL | N | N | silent_mutation | Average:11.15; most accessible tissue: Callus, score: 30.903 | N | N | N | N |
| vg1216541381 | C -> T | LOC_Os12g28040.1 | upstream_gene_variant ; 1509.0bp to feature; MODIFIER | silent_mutation | Average:11.15; most accessible tissue: Callus, score: 30.903 | N | N | N | N |
| vg1216541381 | C -> T | LOC_Os12g28050.1 | downstream_gene_variant ; 2061.0bp to feature; MODIFIER | silent_mutation | Average:11.15; most accessible tissue: Callus, score: 30.903 | N | N | N | N |
| vg1216541381 | C -> T | LOC_Os12g28040-LOC_Os12g28050 | intergenic_region ; MODIFIER | silent_mutation | Average:11.15; most accessible tissue: Callus, score: 30.903 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216541381 | NA | 4.23E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216541381 | NA | 3.36E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216541381 | NA | 1.36E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216541381 | NA | 3.22E-06 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216541381 | NA | 2.67E-06 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216541381 | 2.28E-06 | 2.88E-08 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216541381 | 6.94E-06 | 1.02E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216541381 | NA | 2.50E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216541381 | 4.89E-08 | NA | mr1695_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216541381 | 3.53E-06 | NA | mr1695_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |