\
| Variant ID: vg1216535929 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16535929 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAGAAGAGGAGGAGGAAGGGGGAGAGGAGTGTACAGGGGGGATGGGGTTCCCGCAGAAGGTGACTTTTTCACCGGGGTTTTCCACCAACGAAAAGAACGA[A/T]
CAACTGGCAGGGCAACTTTGCGAGGCTATCAACTTTGTATTGATTTAATTACAATCAATACAATGATATAATCGGGATCGTAGATTGGATAATTATTTTT
AAAAATAATTATCCAATCTACGATCCCGATTATATCATTGTATTGATTGTAATTAAATCAATACAAAGTTGATAGCCTCGCAAAGTTGCCCTGCCAGTTG[T/A]
TCGTTCTTTTCGTTGGTGGAAAACCCCGGTGAAAAAGTCACCTTCTGCGGGAACCCCATCCCCCCTGTACACTCCTCTCCCCCTTCCTCCTCCTCTTCTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.60% | 7.90% | 4.93% | 0.59% | NA |
| All Indica | 2759 | 90.30% | 0.40% | 8.34% | 1.01% | NA |
| All Japonica | 1512 | 77.70% | 22.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 74.60% | 0.20% | 23.19% | 2.02% | NA |
| Indica II | 465 | 92.30% | 0.40% | 5.59% | 1.72% | NA |
| Indica III | 913 | 98.40% | 0.00% | 1.31% | 0.33% | NA |
| Indica Intermediate | 786 | 91.60% | 0.90% | 6.87% | 0.64% | NA |
| Temperate Japonica | 767 | 83.80% | 16.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 75.00% | 24.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 63.90% | 36.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 7.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216535929 | A -> DEL | N | N | silent_mutation | Average:36.307; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg1216535929 | A -> T | LOC_Os12g28040.1 | downstream_gene_variant ; 1626.0bp to feature; MODIFIER | silent_mutation | Average:36.307; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg1216535929 | A -> T | LOC_Os12g28020-LOC_Os12g28040 | intergenic_region ; MODIFIER | silent_mutation | Average:36.307; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216535929 | 1.68E-07 | NA | mr1071_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216535929 | NA | 1.79E-06 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216535929 | 1.04E-07 | NA | mr1080_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216535929 | NA | 1.96E-06 | mr1080_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216535929 | 7.91E-08 | NA | mr1203_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216535929 | NA | 3.65E-06 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216535929 | 9.07E-07 | NA | mr1613_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216535929 | 8.53E-06 | NA | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216535929 | NA | 1.78E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |