Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1216532158:

Variant ID: vg1216532158 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16532158
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTCGTCTCACTAGAACGACATAGTAACGCGACAATCAATGTTCTAGTAACACGACTACTTTCCGCAGTAACAATGTTATAAAAGCATTTTTGTCTCAGC[C/A,T]
ATCATGTAGTAACTAGACTATTGTCTCGCTGTAACGTTGTTTTAAAGCGTTATGGTGAAAACGGTTCTAAAAAATAATATGTGATGTGAGAGATATTATT

Reverse complement sequence

AATAATATCTCTCACATCACATATTATTTTTTAGAACCGTTTTCACCATAACGCTTTAAAACAACGTTACAGCGAGACAATAGTCTAGTTACTACATGAT[G/T,A]
GCTGAGACAAAAATGCTTTTATAACATTGTTACTGCGGAAAGTAGTCGTGTTACTAGAACATTGATTGTCGCGTTACTATGTCGTTCTAGTGAGACGAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.90%	7.90%	10.56%	25.67%	A: 0.02%
All Indica	2759	53.70%	0.40%	8.77%	37.11%	A: 0.04%
All Japonica	1512	60.30%	22.00%	8.93%	8.80%	NA
Aus	269	43.90%	7.80%	39.41%	8.92%	NA
Indica I	595	39.70%	0.20%	2.52%	57.65%	NA
Indica II	465	27.10%	0.40%	23.23%	49.25%	NA
Indica III	913	78.40%	0.10%	4.93%	16.43%	A: 0.11%
Indica Intermediate	786	51.30%	0.90%	9.41%	38.42%	NA
Temperate Japonica	767	83.30%	15.60%	0.13%	0.91%	NA
Tropical Japonica	504	27.00%	25.00%	25.00%	23.02%	NA
Japonica Intermediate	241	56.40%	36.10%	3.32%	4.15%	NA
VI/Aromatic	96	77.10%	0.00%	7.29%	15.62%	NA
Intermediate	90	63.30%	7.80%	10.00%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216532158	C -> DEL	N	N	silent_mutation	Average:20.159; most accessible tissue: Callus, score: 36.049	N	N	N	N
vg1216532158	C -> A	LOC_Os12g28020.1	downstream_gene_variant ; 1612.0bp to feature; MODIFIER	silent_mutation	Average:20.159; most accessible tissue: Callus, score: 36.049	N	N	N	N
vg1216532158	C -> A	LOC_Os12g28020-LOC_Os12g28040	intergenic_region ; MODIFIER	silent_mutation	Average:20.159; most accessible tissue: Callus, score: 36.049	N	N	N	N
vg1216532158	C -> T	LOC_Os12g28020.1	downstream_gene_variant ; 1612.0bp to feature; MODIFIER	silent_mutation	Average:20.159; most accessible tissue: Callus, score: 36.049	N	N	N	N
vg1216532158	C -> T	LOC_Os12g28020-LOC_Os12g28040	intergenic_region ; MODIFIER	silent_mutation	Average:20.159; most accessible tissue: Callus, score: 36.049	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216532158	2.43E-07	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216532158	NA	3.63E-06	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216532158	2.55E-07	NA	mr1080_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216532158	NA	6.70E-06	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216532158	1.69E-07	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216532158	NA	8.47E-06	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216532158	2.25E-07	NA	mr1613_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216532158	3.57E-06	NA	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216532158	NA	3.94E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251