\
| Variant ID: vg1216532158 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16532158 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCTCGTCTCACTAGAACGACATAGTAACGCGACAATCAATGTTCTAGTAACACGACTACTTTCCGCAGTAACAATGTTATAAAAGCATTTTTGTCTCAGC[C/A,T]
ATCATGTAGTAACTAGACTATTGTCTCGCTGTAACGTTGTTTTAAAGCGTTATGGTGAAAACGGTTCTAAAAAATAATATGTGATGTGAGAGATATTATT
AATAATATCTCTCACATCACATATTATTTTTTAGAACCGTTTTCACCATAACGCTTTAAAACAACGTTACAGCGAGACAATAGTCTAGTTACTACATGAT[G/T,A]
GCTGAGACAAAAATGCTTTTATAACATTGTTACTGCGGAAAGTAGTCGTGTTACTAGAACATTGATTGTCGCGTTACTATGTCGTTCTAGTGAGACGAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.90% | 7.90% | 10.56% | 25.67% | A: 0.02% |
| All Indica | 2759 | 53.70% | 0.40% | 8.77% | 37.11% | A: 0.04% |
| All Japonica | 1512 | 60.30% | 22.00% | 8.93% | 8.80% | NA |
| Aus | 269 | 43.90% | 7.80% | 39.41% | 8.92% | NA |
| Indica I | 595 | 39.70% | 0.20% | 2.52% | 57.65% | NA |
| Indica II | 465 | 27.10% | 0.40% | 23.23% | 49.25% | NA |
| Indica III | 913 | 78.40% | 0.10% | 4.93% | 16.43% | A: 0.11% |
| Indica Intermediate | 786 | 51.30% | 0.90% | 9.41% | 38.42% | NA |
| Temperate Japonica | 767 | 83.30% | 15.60% | 0.13% | 0.91% | NA |
| Tropical Japonica | 504 | 27.00% | 25.00% | 25.00% | 23.02% | NA |
| Japonica Intermediate | 241 | 56.40% | 36.10% | 3.32% | 4.15% | NA |
| VI/Aromatic | 96 | 77.10% | 0.00% | 7.29% | 15.62% | NA |
| Intermediate | 90 | 63.30% | 7.80% | 10.00% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216532158 | C -> DEL | N | N | silent_mutation | Average:20.159; most accessible tissue: Callus, score: 36.049 | N | N | N | N |
| vg1216532158 | C -> A | LOC_Os12g28020.1 | downstream_gene_variant ; 1612.0bp to feature; MODIFIER | silent_mutation | Average:20.159; most accessible tissue: Callus, score: 36.049 | N | N | N | N |
| vg1216532158 | C -> A | LOC_Os12g28020-LOC_Os12g28040 | intergenic_region ; MODIFIER | silent_mutation | Average:20.159; most accessible tissue: Callus, score: 36.049 | N | N | N | N |
| vg1216532158 | C -> T | LOC_Os12g28020.1 | downstream_gene_variant ; 1612.0bp to feature; MODIFIER | silent_mutation | Average:20.159; most accessible tissue: Callus, score: 36.049 | N | N | N | N |
| vg1216532158 | C -> T | LOC_Os12g28020-LOC_Os12g28040 | intergenic_region ; MODIFIER | silent_mutation | Average:20.159; most accessible tissue: Callus, score: 36.049 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216532158 | 2.43E-07 | NA | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216532158 | NA | 3.63E-06 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216532158 | 2.55E-07 | NA | mr1080_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216532158 | NA | 6.70E-06 | mr1080_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216532158 | 1.69E-07 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216532158 | NA | 8.47E-06 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216532158 | 2.25E-07 | NA | mr1613_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216532158 | 3.57E-06 | NA | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216532158 | NA | 3.94E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |