\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216532158:

Variant ID: vg1216532158 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16532158
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCGTCTCACTAGAACGACATAGTAACGCGACAATCAATGTTCTAGTAACACGACTACTTTCCGCAGTAACAATGTTATAAAAGCATTTTTGTCTCAGC[C/A,T]
ATCATGTAGTAACTAGACTATTGTCTCGCTGTAACGTTGTTTTAAAGCGTTATGGTGAAAACGGTTCTAAAAAATAATATGTGATGTGAGAGATATTATT

Reverse complement sequence

AATAATATCTCTCACATCACATATTATTTTTTAGAACCGTTTTCACCATAACGCTTTAAAACAACGTTACAGCGAGACAATAGTCTAGTTACTACATGAT[G/T,A]
GCTGAGACAAAAATGCTTTTATAACATTGTTACTGCGGAAAGTAGTCGTGTTACTAGAACATTGATTGTCGCGTTACTATGTCGTTCTAGTGAGACGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 7.90% 10.56% 25.67% A: 0.02%
All Indica  2759 53.70% 0.40% 8.77% 37.11% A: 0.04%
All Japonica  1512 60.30% 22.00% 8.93% 8.80% NA
Aus  269 43.90% 7.80% 39.41% 8.92% NA
Indica I  595 39.70% 0.20% 2.52% 57.65% NA
Indica II  465 27.10% 0.40% 23.23% 49.25% NA
Indica III  913 78.40% 0.10% 4.93% 16.43% A: 0.11%
Indica Intermediate  786 51.30% 0.90% 9.41% 38.42% NA
Temperate Japonica  767 83.30% 15.60% 0.13% 0.91% NA
Tropical Japonica  504 27.00% 25.00% 25.00% 23.02% NA
Japonica Intermediate  241 56.40% 36.10% 3.32% 4.15% NA
VI/Aromatic  96 77.10% 0.00% 7.29% 15.62% NA
Intermediate  90 63.30% 7.80% 10.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216532158 C -> DEL N N silent_mutation Average:20.159; most accessible tissue: Callus, score: 36.049 N N N N
vg1216532158 C -> A LOC_Os12g28020.1 downstream_gene_variant ; 1612.0bp to feature; MODIFIER silent_mutation Average:20.159; most accessible tissue: Callus, score: 36.049 N N N N
vg1216532158 C -> A LOC_Os12g28020-LOC_Os12g28040 intergenic_region ; MODIFIER silent_mutation Average:20.159; most accessible tissue: Callus, score: 36.049 N N N N
vg1216532158 C -> T LOC_Os12g28020.1 downstream_gene_variant ; 1612.0bp to feature; MODIFIER silent_mutation Average:20.159; most accessible tissue: Callus, score: 36.049 N N N N
vg1216532158 C -> T LOC_Os12g28020-LOC_Os12g28040 intergenic_region ; MODIFIER silent_mutation Average:20.159; most accessible tissue: Callus, score: 36.049 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216532158 2.43E-07 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216532158 NA 3.63E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216532158 2.55E-07 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216532158 NA 6.70E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216532158 1.69E-07 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216532158 NA 8.47E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216532158 2.25E-07 NA mr1613_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216532158 3.57E-06 NA mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216532158 NA 3.94E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251