\
| Variant ID: vg1216527792 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16527792 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 103. )
GGAGCAAGGCTTCCGAGGAAATGATTGCTGCCATCAGGGCAACCACCGCCATCCTCAAGGTTGCATCATCTCCAACACCCATGGCACCACCTCCTCCAGC[A/G]
CCCACCAATTGTTTGATAGAATGCCCCAACAACAACATCAATTGGGTGACGACGAATTCAAGTCACATTGGTGAGGTGCTTGTTCCGACAGCTGACCAGG
CCTGGTCAGCTGTCGGAACAAGCACCTCACCAATGTGACTTGAATTCGTCGTCACCCAATTGATGTTGTTGTTGGGGCATTCTATCAAACAATTGGTGGG[T/C]
GCTGGAGGAGGTGGTGCCATGGGTGTTGGAGATGATGCAACCTTGAGGATGGCGGTGGTTGCCCTGATGGCAGCAATCATTTCCTCGGAAGCCTTGCTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.60% | 18.50% | 0.74% | 38.19% | NA |
| All Indica | 2759 | 48.00% | 2.30% | 0.80% | 48.89% | NA |
| All Japonica | 1512 | 29.80% | 51.90% | 0.60% | 17.66% | NA |
| Aus | 269 | 48.00% | 0.00% | 0.00% | 52.04% | NA |
| Indica I | 595 | 35.50% | 1.50% | 0.34% | 62.69% | NA |
| Indica II | 465 | 19.80% | 3.70% | 1.08% | 75.48% | NA |
| Indica III | 913 | 76.60% | 0.90% | 0.44% | 22.12% | NA |
| Indica Intermediate | 786 | 41.10% | 3.70% | 1.40% | 53.82% | NA |
| Temperate Japonica | 767 | 19.30% | 79.70% | 0.00% | 1.04% | NA |
| Tropical Japonica | 504 | 38.10% | 12.70% | 1.59% | 47.62% | NA |
| Japonica Intermediate | 241 | 46.10% | 45.60% | 0.41% | 7.88% | NA |
| VI/Aromatic | 96 | 75.00% | 1.00% | 2.08% | 21.88% | NA |
| Intermediate | 90 | 41.10% | 25.60% | 2.22% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216527792 | A -> DEL | LOC_Os12g28020.1 | N | frameshift_variant | Average:16.386; most accessible tissue: Callus, score: 54.832 | N | N | N | N |
| vg1216527792 | A -> G | LOC_Os12g28020.1 | synonymous_variant ; p.Ala7Ala; LOW | synonymous_codon | Average:16.386; most accessible tissue: Callus, score: 54.832 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216527792 | NA | 1.10E-06 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216527792 | NA | 8.75E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216527792 | NA | 3.43E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216527792 | NA | 1.88E-06 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216527792 | NA | 9.30E-07 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216527792 | NA | 2.69E-07 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216527792 | NA | 5.01E-06 | mr1129_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216527792 | 1.52E-06 | 1.51E-06 | mr1162_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216527792 | NA | 1.46E-06 | mr1257_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216527792 | NA | 1.80E-06 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216527792 | NA | 3.39E-07 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216527792 | NA | 2.58E-07 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216527792 | NA | 2.45E-07 | mr1754_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216527792 | 5.19E-08 | 5.19E-08 | mr1754_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216527792 | NA | 1.45E-08 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216527792 | NA | 6.20E-09 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |