Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216524512:

Variant ID: vg1216524512 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16524512
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTATGCAACTAACACCATATGCACACCACTTGCTGCCCAAGTCTAAAATCACATTTTACACATTTTAGTTTACAAATACCCATCACATTCATTTTATTC[C/T]
AGCAAAGGTTCATGTGTCCAAAATCACATTTTAATCACAGAGGGTATGAGCATTTGCATATTTCTAAGCATGGCTAAGCAAGTAGTTGCACATAGAGCAT

Reverse complement sequence

ATGCTCTATGTGCAACTACTTGCTTAGCCATGCTTAGAAATATGCAAATGCTCATACCCTCTGTGATTAAAATGTGATTTTGGACACATGAACCTTTGCT[G/A]
GAATAAAATGAATGTGATGGGTATTTGTAAACTAAAATGTGTAAAATGTGATTTTAGACTTGGGCAGCAAGTGGTGTGCATATGGTGTTAGTTGCATACC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.50%	7.90%	3.72%	30.85%	NA
All Indica	2759	54.70%	0.40%	4.71%	40.16%	NA
All Japonica	1512	59.70%	22.20%	0.13%	17.92%	NA
Aus	269	64.30%	7.80%	15.61%	12.27%	NA
Indica I	595	41.00%	0.20%	3.70%	55.13%	NA
Indica II	465	35.50%	0.40%	4.95%	59.14%	NA
Indica III	913	79.20%	0.10%	2.08%	18.62%	NA
Indica Intermediate	786	48.10%	0.90%	8.40%	42.62%	NA
Temperate Japonica	767	82.80%	16.20%	0.13%	0.91%	NA
Tropical Japonica	504	26.20%	25.00%	0.20%	48.61%	NA
Japonica Intermediate	241	56.40%	35.70%	0.00%	7.88%	NA
VI/Aromatic	96	76.00%	0.00%	2.08%	21.88%	NA
Intermediate	90	64.40%	7.80%	0.00%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216524512	C -> DEL	N	N	silent_mutation	Average:9.472; most accessible tissue: Callus, score: 41.306	N	N	N	N
vg1216524512	C -> T	LOC_Os12g28020.1	upstream_gene_variant ; 3260.0bp to feature; MODIFIER	silent_mutation	Average:9.472; most accessible tissue: Callus, score: 41.306	N	N	N	N
vg1216524512	C -> T	LOC_Os12g28015.1	downstream_gene_variant ; 4181.0bp to feature; MODIFIER	silent_mutation	Average:9.472; most accessible tissue: Callus, score: 41.306	N	N	N	N
vg1216524512	C -> T	LOC_Os12g28015-LOC_Os12g28020	intergenic_region ; MODIFIER	silent_mutation	Average:9.472; most accessible tissue: Callus, score: 41.306	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216524512	1.75E-07	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524512	NA	1.79E-06	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524512	1.23E-07	NA	mr1080_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524512	NA	1.96E-06	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524512	1.14E-07	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524512	NA	3.65E-06	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524512	5.05E-07	NA	mr1613_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524512	8.53E-06	NA	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524512	NA	1.78E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251