\
| Variant ID: vg1216524512 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16524512 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGTATGCAACTAACACCATATGCACACCACTTGCTGCCCAAGTCTAAAATCACATTTTACACATTTTAGTTTACAAATACCCATCACATTCATTTTATTC[C/T]
AGCAAAGGTTCATGTGTCCAAAATCACATTTTAATCACAGAGGGTATGAGCATTTGCATATTTCTAAGCATGGCTAAGCAAGTAGTTGCACATAGAGCAT
ATGCTCTATGTGCAACTACTTGCTTAGCCATGCTTAGAAATATGCAAATGCTCATACCCTCTGTGATTAAAATGTGATTTTGGACACATGAACCTTTGCT[G/A]
GAATAAAATGAATGTGATGGGTATTTGTAAACTAAAATGTGTAAAATGTGATTTTAGACTTGGGCAGCAAGTGGTGTGCATATGGTGTTAGTTGCATACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.50% | 7.90% | 3.72% | 30.85% | NA |
| All Indica | 2759 | 54.70% | 0.40% | 4.71% | 40.16% | NA |
| All Japonica | 1512 | 59.70% | 22.20% | 0.13% | 17.92% | NA |
| Aus | 269 | 64.30% | 7.80% | 15.61% | 12.27% | NA |
| Indica I | 595 | 41.00% | 0.20% | 3.70% | 55.13% | NA |
| Indica II | 465 | 35.50% | 0.40% | 4.95% | 59.14% | NA |
| Indica III | 913 | 79.20% | 0.10% | 2.08% | 18.62% | NA |
| Indica Intermediate | 786 | 48.10% | 0.90% | 8.40% | 42.62% | NA |
| Temperate Japonica | 767 | 82.80% | 16.20% | 0.13% | 0.91% | NA |
| Tropical Japonica | 504 | 26.20% | 25.00% | 0.20% | 48.61% | NA |
| Japonica Intermediate | 241 | 56.40% | 35.70% | 0.00% | 7.88% | NA |
| VI/Aromatic | 96 | 76.00% | 0.00% | 2.08% | 21.88% | NA |
| Intermediate | 90 | 64.40% | 7.80% | 0.00% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216524512 | C -> DEL | N | N | silent_mutation | Average:9.472; most accessible tissue: Callus, score: 41.306 | N | N | N | N |
| vg1216524512 | C -> T | LOC_Os12g28020.1 | upstream_gene_variant ; 3260.0bp to feature; MODIFIER | silent_mutation | Average:9.472; most accessible tissue: Callus, score: 41.306 | N | N | N | N |
| vg1216524512 | C -> T | LOC_Os12g28015.1 | downstream_gene_variant ; 4181.0bp to feature; MODIFIER | silent_mutation | Average:9.472; most accessible tissue: Callus, score: 41.306 | N | N | N | N |
| vg1216524512 | C -> T | LOC_Os12g28015-LOC_Os12g28020 | intergenic_region ; MODIFIER | silent_mutation | Average:9.472; most accessible tissue: Callus, score: 41.306 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216524512 | 1.75E-07 | NA | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216524512 | NA | 1.79E-06 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216524512 | 1.23E-07 | NA | mr1080_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216524512 | NA | 1.96E-06 | mr1080_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216524512 | 1.14E-07 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216524512 | NA | 3.65E-06 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216524512 | 5.05E-07 | NA | mr1613_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216524512 | 8.53E-06 | NA | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216524512 | NA | 1.78E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |