\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216524512:

Variant ID: vg1216524512 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16524512
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTATGCAACTAACACCATATGCACACCACTTGCTGCCCAAGTCTAAAATCACATTTTACACATTTTAGTTTACAAATACCCATCACATTCATTTTATTC[C/T]
AGCAAAGGTTCATGTGTCCAAAATCACATTTTAATCACAGAGGGTATGAGCATTTGCATATTTCTAAGCATGGCTAAGCAAGTAGTTGCACATAGAGCAT

Reverse complement sequence

ATGCTCTATGTGCAACTACTTGCTTAGCCATGCTTAGAAATATGCAAATGCTCATACCCTCTGTGATTAAAATGTGATTTTGGACACATGAACCTTTGCT[G/A]
GAATAAAATGAATGTGATGGGTATTTGTAAACTAAAATGTGTAAAATGTGATTTTAGACTTGGGCAGCAAGTGGTGTGCATATGGTGTTAGTTGCATACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.50% 7.90% 3.72% 30.85% NA
All Indica  2759 54.70% 0.40% 4.71% 40.16% NA
All Japonica  1512 59.70% 22.20% 0.13% 17.92% NA
Aus  269 64.30% 7.80% 15.61% 12.27% NA
Indica I  595 41.00% 0.20% 3.70% 55.13% NA
Indica II  465 35.50% 0.40% 4.95% 59.14% NA
Indica III  913 79.20% 0.10% 2.08% 18.62% NA
Indica Intermediate  786 48.10% 0.90% 8.40% 42.62% NA
Temperate Japonica  767 82.80% 16.20% 0.13% 0.91% NA
Tropical Japonica  504 26.20% 25.00% 0.20% 48.61% NA
Japonica Intermediate  241 56.40% 35.70% 0.00% 7.88% NA
VI/Aromatic  96 76.00% 0.00% 2.08% 21.88% NA
Intermediate  90 64.40% 7.80% 0.00% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216524512 C -> DEL N N silent_mutation Average:9.472; most accessible tissue: Callus, score: 41.306 N N N N
vg1216524512 C -> T LOC_Os12g28020.1 upstream_gene_variant ; 3260.0bp to feature; MODIFIER silent_mutation Average:9.472; most accessible tissue: Callus, score: 41.306 N N N N
vg1216524512 C -> T LOC_Os12g28015.1 downstream_gene_variant ; 4181.0bp to feature; MODIFIER silent_mutation Average:9.472; most accessible tissue: Callus, score: 41.306 N N N N
vg1216524512 C -> T LOC_Os12g28015-LOC_Os12g28020 intergenic_region ; MODIFIER silent_mutation Average:9.472; most accessible tissue: Callus, score: 41.306 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216524512 1.75E-07 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524512 NA 1.79E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524512 1.23E-07 NA mr1080_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524512 NA 1.96E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524512 1.14E-07 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524512 NA 3.65E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524512 5.05E-07 NA mr1613_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524512 8.53E-06 NA mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524512 NA 1.78E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251