\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216515188:

Variant ID: vg1216515188 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16515188
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCGATTTAATATCGGGGACACTTGCACAATAGATATTGTATAAAAAACATGCTCTAGGTAGACATAATAAATTACTGATCTGACAATATCGTATAAATT[A/G]
GAAAAACAGGTACGATAAATTACATATAAAATATTGCGTACCTGTGTAGATACATGCCGGATGTATCTACAAAATTAGTAGATCAATTAAAATAATTGAT

Reverse complement sequence

ATCAATTATTTTAATTGATCTACTAATTTTGTAGATACATCCGGCATGTATCTACACAGGTACGCAATATTTTATATGTAATTTATCGTACCTGTTTTTC[T/C]
AATTTATACGATATTGTCAGATCAGTAATTTATTATGTCTACCTAGAGCATGTTTTTTATACAATATCTATTGTGCAAGTGTCCCCGATATTAAATCGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.80% 25.90% 0.93% 44.33% NA
All Indica  2759 33.60% 6.10% 1.12% 59.19% NA
All Japonica  1512 15.00% 66.30% 0.07% 18.65% NA
Aus  269 39.40% 8.60% 3.35% 48.70% NA
Indica I  595 29.60% 2.40% 2.35% 65.71% NA
Indica II  465 7.10% 5.60% 1.08% 86.24% NA
Indica III  913 56.20% 8.30% 0.00% 35.49% NA
Indica Intermediate  786 26.00% 6.70% 1.53% 65.78% NA
Temperate Japonica  767 9.80% 89.00% 0.00% 1.17% NA
Tropical Japonica  504 21.20% 28.80% 0.20% 49.80% NA
Japonica Intermediate  241 18.70% 72.20% 0.00% 9.13% NA
VI/Aromatic  96 74.00% 1.00% 0.00% 25.00% NA
Intermediate  90 36.70% 32.20% 3.33% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216515188 A -> DEL N N silent_mutation Average:14.145; most accessible tissue: Callus, score: 98.581 N N N N
vg1216515188 A -> G LOC_Os12g28015.1 upstream_gene_variant ; 4523.0bp to feature; MODIFIER silent_mutation Average:14.145; most accessible tissue: Callus, score: 98.581 N N N N
vg1216515188 A -> G LOC_Os12g28010.1 intron_variant ; MODIFIER silent_mutation Average:14.145; most accessible tissue: Callus, score: 98.581 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216515188 7.09E-06 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 3.00E-07 NA mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 NA 1.64E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 NA 8.15E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 NA 3.67E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 NA 9.33E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 6.46E-06 NA mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 3.93E-07 3.05E-09 mr1240 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 NA 4.16E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 1.27E-06 1.54E-07 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 3.76E-07 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 NA 1.23E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 NA 3.27E-06 mr1677 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 3.86E-06 2.64E-07 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 NA 8.94E-07 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 NA 6.13E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 NA 3.07E-08 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 8.70E-06 NA mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 2.38E-06 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 2.67E-08 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 2.80E-06 NA mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 1.73E-07 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 2.53E-06 NA mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216515188 7.53E-06 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251