\
| Variant ID: vg1216514861 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16514861 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.19, others allele: 0.00, population size: 100. )
AGTAGTCCAGCCATGGCCAGTGCTATGAGATAGGTTGTCGGTCTTAGTTGGTAGGTTGGGCGCGACGACTCTGCATTTGTTGAGATCGTTCTCGATAATA[T/C]
GGTGTACTCGACCACAACCTACTCGAGTGCTCAACTGTTCCTGAAAAATGTTTTCTAGAAGGCAAGACATATAGCAGGTAATATCGAGTATGTATTCGAA
TTCGAATACATACTCGATATTACCTGCTATATGTCTTGCCTTCTAGAAAACATTTTTCAGGAACAGTTGAGCACTCGAGTAGGTTGTGGTCGAGTACACC[A/G]
TATTATCGAGAACGATCTCAACAAATGCAGAGTCGTCGCGCCCAACCTACCAACTAAGACCGACAACCTATCTCATAGCACTGGCCATGGCTGGACTACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.60% | 21.20% | 0.40% | 44.71% | NA |
| All Indica | 2759 | 31.00% | 9.00% | 0.33% | 59.66% | NA |
| All Japonica | 1512 | 34.90% | 46.40% | 0.40% | 18.25% | NA |
| Aus | 269 | 39.40% | 7.80% | 0.00% | 52.79% | NA |
| Indica I | 595 | 12.90% | 18.80% | 1.01% | 67.23% | NA |
| Indica II | 465 | 6.50% | 6.70% | 0.00% | 86.88% | NA |
| Indica III | 913 | 60.10% | 4.50% | 0.00% | 35.38% | NA |
| Indica Intermediate | 786 | 25.40% | 8.10% | 0.38% | 66.03% | NA |
| Temperate Japonica | 767 | 22.70% | 76.10% | 0.00% | 1.17% | NA |
| Tropical Japonica | 504 | 46.20% | 4.20% | 1.19% | 48.41% | NA |
| Japonica Intermediate | 241 | 50.20% | 40.20% | 0.00% | 9.54% | NA |
| VI/Aromatic | 96 | 64.60% | 8.30% | 3.12% | 23.96% | NA |
| Intermediate | 90 | 42.20% | 27.80% | 1.11% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216514861 | T -> C | LOC_Os12g28010.1 | missense_variant ; p.His81Arg; MODERATE | nonsynonymous_codon ; H81R | Average:7.914; most accessible tissue: Callus, score: 23.275 | unknown | unknown | TOLERATED | 0.57 |
| vg1216514861 | T -> DEL | LOC_Os12g28010.1 | N | frameshift_variant | Average:7.914; most accessible tissue: Callus, score: 23.275 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216514861 | NA | 7.48E-06 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216514861 | 3.64E-06 | NA | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216514861 | 7.95E-07 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216514861 | 7.16E-06 | NA | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216514861 | 1.23E-06 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216514861 | 2.88E-06 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216514861 | 8.68E-10 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216514861 | 2.39E-08 | NA | mr1778_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |