\
| Variant ID: vg1216512330 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16512330 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.20, others allele: 0.00, population size: 86. )
ACTGTTGTCGACATGGCGGTCTGAAGATCTGACTCGTAGTCGACAACAGGGTAGTTTTCCTCCTCAAATCCGTGCCCGGCGAGATCAGAGATAGCGCTTT[T/C]
GTTTCTCCTAACAGTATCTGGAGACATCGTAGGGGACTAGCCGTGCCTATCCCTGAAGTCGATATCCGGTGTCTTGTCTTGGCGTATGTTGGCTTGTATG
CATACAAGCCAACATACGCCAAGACAAGACACCGGATATCGACTTCAGGGATAGGCACGGCTAGTCCCCTACGATGTCTCCAGATACTGTTAGGAGAAAC[A/G]
AAAGCGCTATCTCTGATCTCGCCGGGCACGGATTTGAGGAGGAAAACTACCCTGTTGTCGACTACGAGTCAGATCTTCAGACCGCCATGTCGACAACAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.00% | 16.60% | 0.63% | 44.73% | NA |
| All Indica | 2759 | 37.40% | 2.40% | 0.94% | 59.30% | NA |
| All Japonica | 1512 | 35.00% | 46.10% | 0.07% | 18.85% | NA |
| Aus | 269 | 47.20% | 0.00% | 0.00% | 52.79% | NA |
| Indica I | 595 | 29.90% | 1.50% | 1.18% | 67.39% | NA |
| Indica II | 465 | 8.40% | 3.90% | 1.29% | 86.45% | NA |
| Indica III | 913 | 64.00% | 0.50% | 0.22% | 35.27% | NA |
| Indica Intermediate | 786 | 29.40% | 4.20% | 1.40% | 65.01% | NA |
| Temperate Japonica | 767 | 22.80% | 76.00% | 0.00% | 1.17% | NA |
| Tropical Japonica | 504 | 46.00% | 3.60% | 0.20% | 50.20% | NA |
| Japonica Intermediate | 241 | 50.60% | 39.80% | 0.00% | 9.54% | NA |
| VI/Aromatic | 96 | 72.90% | 0.00% | 2.08% | 25.00% | NA |
| Intermediate | 90 | 42.20% | 26.70% | 1.11% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216512330 | T -> C | LOC_Os12g27994.2 | upstream_gene_variant ; 4442.0bp to feature; MODIFIER | silent_mutation | Average:5.546; most accessible tissue: Zhenshan97 young leaf, score: 10.848 | N | N | N | N |
| vg1216512330 | T -> C | LOC_Os12g28010.1 | downstream_gene_variant ; 2428.0bp to feature; MODIFIER | silent_mutation | Average:5.546; most accessible tissue: Zhenshan97 young leaf, score: 10.848 | N | N | N | N |
| vg1216512330 | T -> C | LOC_Os12g27994-LOC_Os12g28010 | intergenic_region ; MODIFIER | silent_mutation | Average:5.546; most accessible tissue: Zhenshan97 young leaf, score: 10.848 | N | N | N | N |
| vg1216512330 | T -> DEL | N | N | silent_mutation | Average:5.546; most accessible tissue: Zhenshan97 young leaf, score: 10.848 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216512330 | 8.43E-06 | NA | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216512330 | 4.82E-06 | NA | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216512330 | NA | 1.49E-08 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216512330 | 1.77E-06 | NA | mr1022_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216512330 | 1.51E-09 | NA | mr1023_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216512330 | 8.12E-09 | NA | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216512330 | NA | 4.28E-06 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216512330 | 1.01E-08 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216512330 | 2.22E-06 | NA | mr1490_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216512330 | 2.70E-07 | NA | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |