\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216512330:

Variant ID: vg1216512330 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16512330
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.20, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


ACTGTTGTCGACATGGCGGTCTGAAGATCTGACTCGTAGTCGACAACAGGGTAGTTTTCCTCCTCAAATCCGTGCCCGGCGAGATCAGAGATAGCGCTTT[T/C]
GTTTCTCCTAACAGTATCTGGAGACATCGTAGGGGACTAGCCGTGCCTATCCCTGAAGTCGATATCCGGTGTCTTGTCTTGGCGTATGTTGGCTTGTATG

Reverse complement sequence

CATACAAGCCAACATACGCCAAGACAAGACACCGGATATCGACTTCAGGGATAGGCACGGCTAGTCCCCTACGATGTCTCCAGATACTGTTAGGAGAAAC[A/G]
AAAGCGCTATCTCTGATCTCGCCGGGCACGGATTTGAGGAGGAAAACTACCCTGTTGTCGACTACGAGTCAGATCTTCAGACCGCCATGTCGACAACAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.00% 16.60% 0.63% 44.73% NA
All Indica  2759 37.40% 2.40% 0.94% 59.30% NA
All Japonica  1512 35.00% 46.10% 0.07% 18.85% NA
Aus  269 47.20% 0.00% 0.00% 52.79% NA
Indica I  595 29.90% 1.50% 1.18% 67.39% NA
Indica II  465 8.40% 3.90% 1.29% 86.45% NA
Indica III  913 64.00% 0.50% 0.22% 35.27% NA
Indica Intermediate  786 29.40% 4.20% 1.40% 65.01% NA
Temperate Japonica  767 22.80% 76.00% 0.00% 1.17% NA
Tropical Japonica  504 46.00% 3.60% 0.20% 50.20% NA
Japonica Intermediate  241 50.60% 39.80% 0.00% 9.54% NA
VI/Aromatic  96 72.90% 0.00% 2.08% 25.00% NA
Intermediate  90 42.20% 26.70% 1.11% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216512330 T -> C LOC_Os12g27994.2 upstream_gene_variant ; 4442.0bp to feature; MODIFIER silent_mutation Average:5.546; most accessible tissue: Zhenshan97 young leaf, score: 10.848 N N N N
vg1216512330 T -> C LOC_Os12g28010.1 downstream_gene_variant ; 2428.0bp to feature; MODIFIER silent_mutation Average:5.546; most accessible tissue: Zhenshan97 young leaf, score: 10.848 N N N N
vg1216512330 T -> C LOC_Os12g27994-LOC_Os12g28010 intergenic_region ; MODIFIER silent_mutation Average:5.546; most accessible tissue: Zhenshan97 young leaf, score: 10.848 N N N N
vg1216512330 T -> DEL N N silent_mutation Average:5.546; most accessible tissue: Zhenshan97 young leaf, score: 10.848 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216512330 8.43E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216512330 4.82E-06 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216512330 NA 1.49E-08 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216512330 1.77E-06 NA mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216512330 1.51E-09 NA mr1023_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216512330 8.12E-09 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216512330 NA 4.28E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216512330 1.01E-08 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216512330 2.22E-06 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216512330 2.70E-07 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251