Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216512330:

Variant ID: vg1216512330 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16512330
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.20, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

ACTGTTGTCGACATGGCGGTCTGAAGATCTGACTCGTAGTCGACAACAGGGTAGTTTTCCTCCTCAAATCCGTGCCCGGCGAGATCAGAGATAGCGCTTT[T/C]
GTTTCTCCTAACAGTATCTGGAGACATCGTAGGGGACTAGCCGTGCCTATCCCTGAAGTCGATATCCGGTGTCTTGTCTTGGCGTATGTTGGCTTGTATG

Reverse complement sequence

CATACAAGCCAACATACGCCAAGACAAGACACCGGATATCGACTTCAGGGATAGGCACGGCTAGTCCCCTACGATGTCTCCAGATACTGTTAGGAGAAAC[A/G]
AAAGCGCTATCTCTGATCTCGCCGGGCACGGATTTGAGGAGGAAAACTACCCTGTTGTCGACTACGAGTCAGATCTTCAGACCGCCATGTCGACAACAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.00%	16.60%	0.63%	44.73%	NA
All Indica	2759	37.40%	2.40%	0.94%	59.30%	NA
All Japonica	1512	35.00%	46.10%	0.07%	18.85%	NA
Aus	269	47.20%	0.00%	0.00%	52.79%	NA
Indica I	595	29.90%	1.50%	1.18%	67.39%	NA
Indica II	465	8.40%	3.90%	1.29%	86.45%	NA
Indica III	913	64.00%	0.50%	0.22%	35.27%	NA
Indica Intermediate	786	29.40%	4.20%	1.40%	65.01%	NA
Temperate Japonica	767	22.80%	76.00%	0.00%	1.17%	NA
Tropical Japonica	504	46.00%	3.60%	0.20%	50.20%	NA
Japonica Intermediate	241	50.60%	39.80%	0.00%	9.54%	NA
VI/Aromatic	96	72.90%	0.00%	2.08%	25.00%	NA
Intermediate	90	42.20%	26.70%	1.11%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216512330	T -> C	LOC_Os12g27994.2	upstream_gene_variant ; 4442.0bp to feature; MODIFIER	silent_mutation	Average:5.546; most accessible tissue: Zhenshan97 young leaf, score: 10.848	N	N	N	N
vg1216512330	T -> C	LOC_Os12g28010.1	downstream_gene_variant ; 2428.0bp to feature; MODIFIER	silent_mutation	Average:5.546; most accessible tissue: Zhenshan97 young leaf, score: 10.848	N	N	N	N
vg1216512330	T -> C	LOC_Os12g27994-LOC_Os12g28010	intergenic_region ; MODIFIER	silent_mutation	Average:5.546; most accessible tissue: Zhenshan97 young leaf, score: 10.848	N	N	N	N
vg1216512330	T -> DEL	N	N	silent_mutation	Average:5.546; most accessible tissue: Zhenshan97 young leaf, score: 10.848	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216512330	8.43E-06	NA	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216512330	4.82E-06	NA	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216512330	NA	1.49E-08	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216512330	1.77E-06	NA	mr1022_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216512330	1.51E-09	NA	mr1023_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216512330	8.12E-09	NA	mr1079_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216512330	NA	4.28E-06	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216512330	1.01E-08	NA	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216512330	2.22E-06	NA	mr1490_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216512330	2.70E-07	NA	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251