\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216486981:

Variant ID: vg1216486981 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16486981
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, A: 0.29, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TATTTTGTTCAAATTTGACTAAATTTGTTCAAAATTTTCAGAAATTTCAGACCCAATTTTTGGAAATTTTGGTATATTGGCACCCTCCGATAGAATCCAA[A/T]
CCAAAAGATTAAACCCTAGTCATAGTTGAGGAGAAATTTGATAATCTAACACTTTTTTCCCAATTGCTTTAACCAACACTTGTGAGGATGACATGTGGGA

Reverse complement sequence

TCCCACATGTCATCCTCACAAGTGTTGGTTAAAGCAATTGGGAAAAAAGTGTTAGATTATCAAATTTCTCCTCAACTATGACTAGGGTTTAATCTTTTGG[T/A]
TTGGATTCTATCGGAGGGTGCCAATATACCAAAATTTCCAAAAATTGGGTCTGAAATTTCTGAAAATTTTGAACAAATTTAGTCAAATTTGAACAAAATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 41.90% 0.06% 0.00% NA
All Indica  2759 54.30% 45.60% 0.07% 0.00% NA
All Japonica  1512 67.10% 32.90% 0.00% 0.00% NA
Aus  269 53.90% 46.10% 0.00% 0.00% NA
Indica I  595 68.10% 31.90% 0.00% 0.00% NA
Indica II  465 83.70% 16.30% 0.00% 0.00% NA
Indica III  913 23.70% 76.20% 0.11% 0.00% NA
Indica Intermediate  786 62.10% 37.80% 0.13% 0.00% NA
Temperate Japonica  767 80.10% 19.90% 0.00% 0.00% NA
Tropical Japonica  504 55.20% 44.80% 0.00% 0.00% NA
Japonica Intermediate  241 51.00% 49.00% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 65.60% 33.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216486981 A -> T LOC_Os12g27950.1 downstream_gene_variant ; 3957.0bp to feature; MODIFIER silent_mutation Average:32.768; most accessible tissue: Callus, score: 62.538 N N N N
vg1216486981 A -> T LOC_Os12g27960.1 downstream_gene_variant ; 249.0bp to feature; MODIFIER silent_mutation Average:32.768; most accessible tissue: Callus, score: 62.538 N N N N
vg1216486981 A -> T LOC_Os12g27960-LOC_Os12g27980 intergenic_region ; MODIFIER silent_mutation Average:32.768; most accessible tissue: Callus, score: 62.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216486981 8.51E-06 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 9.46E-06 NA mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 9.04E-06 NA mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 1.17E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 4.13E-06 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 NA 4.50E-09 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 3.12E-07 NA mr1022_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 1.18E-08 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 1.71E-06 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 3.18E-10 NA mr1079_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 6.94E-06 NA mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 1.05E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 3.64E-06 NA mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 NA 3.99E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 8.83E-07 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 2.79E-10 NA mr1489_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 1.02E-07 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 6.21E-06 NA mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 NA 2.14E-06 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981 6.50E-08 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251