Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216486981:

Variant ID: vg1216486981 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16486981
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, A: 0.29, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TATTTTGTTCAAATTTGACTAAATTTGTTCAAAATTTTCAGAAATTTCAGACCCAATTTTTGGAAATTTTGGTATATTGGCACCCTCCGATAGAATCCAA[A/T]
CCAAAAGATTAAACCCTAGTCATAGTTGAGGAGAAATTTGATAATCTAACACTTTTTTCCCAATTGCTTTAACCAACACTTGTGAGGATGACATGTGGGA

Reverse complement sequence

TCCCACATGTCATCCTCACAAGTGTTGGTTAAAGCAATTGGGAAAAAAGTGTTAGATTATCAAATTTCTCCTCAACTATGACTAGGGTTTAATCTTTTGG[T/A]
TTGGATTCTATCGGAGGGTGCCAATATACCAAAATTTCCAAAAATTGGGTCTGAAATTTCTGAAAATTTTGAACAAATTTAGTCAAATTTGAACAAAATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.00%	41.90%	0.06%	0.00%	NA
All Indica	2759	54.30%	45.60%	0.07%	0.00%	NA
All Japonica	1512	67.10%	32.90%	0.00%	0.00%	NA
Aus	269	53.90%	46.10%	0.00%	0.00%	NA
Indica I	595	68.10%	31.90%	0.00%	0.00%	NA
Indica II	465	83.70%	16.30%	0.00%	0.00%	NA
Indica III	913	23.70%	76.20%	0.11%	0.00%	NA
Indica Intermediate	786	62.10%	37.80%	0.13%	0.00%	NA
Temperate Japonica	767	80.10%	19.90%	0.00%	0.00%	NA
Tropical Japonica	504	55.20%	44.80%	0.00%	0.00%	NA
Japonica Intermediate	241	51.00%	49.00%	0.00%	0.00%	NA
VI/Aromatic	96	27.10%	72.90%	0.00%	0.00%	NA
Intermediate	90	65.60%	33.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216486981	A -> T	LOC_Os12g27950.1	downstream_gene_variant ; 3957.0bp to feature; MODIFIER	silent_mutation	Average:32.768; most accessible tissue: Callus, score: 62.538	N	N	N	N
vg1216486981	A -> T	LOC_Os12g27960.1	downstream_gene_variant ; 249.0bp to feature; MODIFIER	silent_mutation	Average:32.768; most accessible tissue: Callus, score: 62.538	N	N	N	N
vg1216486981	A -> T	LOC_Os12g27960-LOC_Os12g27980	intergenic_region ; MODIFIER	silent_mutation	Average:32.768; most accessible tissue: Callus, score: 62.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216486981	8.51E-06	NA	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	9.46E-06	NA	mr1079	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	9.04E-06	NA	mr1490	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	1.17E-06	NA	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	4.13E-06	NA	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	NA	4.50E-09	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	3.12E-07	NA	mr1022_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	1.18E-08	NA	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	1.71E-06	NA	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	3.18E-10	NA	mr1079_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	6.94E-06	NA	mr1079_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	1.05E-06	NA	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	3.64E-06	NA	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	NA	3.99E-06	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	8.83E-07	NA	mr1390_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	2.79E-10	NA	mr1489_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	1.02E-07	NA	mr1490_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	6.21E-06	NA	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	NA	2.14E-06	mr1582_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216486981	6.50E-08	NA	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251