\
| Variant ID: vg1216482741 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16482741 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTATACGGATTACCAGGCAACTGCGTGTGCTTGCGCTGCATGAACGACTTCGTCGTCGTCGGCCAGCAGCTGGCGGAGAACGATCACGGCGAGCTCGGCG[G/T]
CGGCGGCGACGAGCACACGATGTACACGTTCGAGGTGACGGTGACGAACCGGTGCTGCTGCGAGGTGAGCAGCGTCGTCGTGGCGGCGCCGGGGTTCCGG
CCGGAACCCCGGCGCCGCCACGACGACGCTGCTCACCTCGCAGCAGCACCGGTTCGTCACCGTCACCTCGAACGTGTACATCGTGTGCTCGTCGCCGCCG[C/A]
CGCCGAGCTCGCCGTGATCGTTCTCCGCCAGCTGCTGGCCGACGACGACGAAGTCGTTCATGCAGCGCAAGCACACGCAGTTGCCTGGTAATCCGTATAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.00% | 27.00% | 0.93% | 13.01% | NA |
| All Indica | 2759 | 54.30% | 32.10% | 0.58% | 12.98% | NA |
| All Japonica | 1512 | 70.00% | 20.00% | 1.46% | 8.60% | NA |
| Aus | 269 | 54.30% | 17.80% | 1.49% | 26.39% | NA |
| Indica I | 595 | 67.90% | 27.90% | 0.17% | 4.03% | NA |
| Indica II | 465 | 84.10% | 6.20% | 0.65% | 9.03% | NA |
| Indica III | 913 | 24.20% | 54.00% | 0.44% | 21.36% | NA |
| Indica Intermediate | 786 | 61.50% | 25.20% | 1.02% | 12.34% | NA |
| Temperate Japonica | 767 | 83.70% | 9.00% | 1.30% | 6.00% | NA |
| Tropical Japonica | 504 | 55.20% | 34.10% | 0.60% | 10.12% | NA |
| Japonica Intermediate | 241 | 57.30% | 25.30% | 3.73% | 13.69% | NA |
| VI/Aromatic | 96 | 28.10% | 16.70% | 2.08% | 53.12% | NA |
| Intermediate | 90 | 66.70% | 27.80% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216482741 | G -> DEL | LOC_Os12g27950.1 | N | frameshift_variant | Average:61.97; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| vg1216482741 | G -> T | LOC_Os12g27950.1 | missense_variant ; p.Gly47Val; MODERATE | nonsynonymous_codon ; G47V | Average:61.97; most accessible tissue: Zhenshan97 panicle, score: 78.302 | unknown | unknown | TOLERATED | 0.28 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216482741 | 5.10E-06 | NA | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216482741 | 5.09E-06 | NA | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216482741 | NA | 4.91E-09 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216482741 | 9.21E-06 | NA | mr1022_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216482741 | 3.04E-06 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216482741 | 3.66E-09 | NA | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216482741 | 5.36E-08 | NA | mr1079_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216482741 | 8.55E-07 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216482741 | 1.36E-08 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216482741 | NA | 8.35E-07 | mr1582_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216482741 | 2.19E-06 | NA | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |