Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216469080:

Variant ID: vg1216469080 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16469080
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGATAGATAGATAGATAGGATGAATGGAAGATAGTCAAACAGACTTTAGATAGATAGATAGATAGATGAATTACTCGCCACCATAGTTTCTATAAGCAC[A/G]
CTTTCATAGTATAAATACATGTGACCCCAATGAGGAACTCCAACACATCCCATGCATACAACATTTTGACCTTTTTATTTAAGAATTAGAGTAGAGTTAA

Reverse complement sequence

TTAACTCTACTCTAATTCTTAAATAAAAAGGTCAAAATGTTGTATGCATGGGATGTGTTGGAGTTCCTCATTGGGGTCACATGTATTTATACTATGAAAG[T/C]
GTGCTTATAGAAACTATGGTGGCGAGTAATTCATCTATCTATCTATCTATCTAAAGTCTGTTTGACTATCTTCCATTCATCCTATCTATCTATCTATCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.50%	18.90%	0.17%	14.37%	NA
All Indica	2759	83.70%	2.70%	0.04%	13.59%	NA
All Japonica	1512	35.50%	52.60%	0.46%	11.38%	NA
Aus	269	72.50%	1.10%	0.00%	26.39%	NA
Indica I	595	93.10%	2.70%	0.00%	4.20%	NA
Indica II	465	85.80%	4.50%	0.00%	9.68%	NA
Indica III	913	77.70%	0.20%	0.11%	22.02%	NA
Indica Intermediate	786	82.30%	4.50%	0.00%	13.23%	NA
Temperate Japonica	767	8.70%	84.00%	0.26%	7.04%	NA
Tropical Japonica	504	82.30%	4.60%	0.60%	12.50%	NA
Japonica Intermediate	241	22.80%	53.50%	0.83%	22.82%	NA
VI/Aromatic	96	42.70%	1.00%	0.00%	56.25%	NA
Intermediate	90	68.90%	23.30%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216469080	A -> DEL	N	N	silent_mutation	Average:45.289; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg1216469080	A -> G	LOC_Os12g27940.1	upstream_gene_variant ; 39.0bp to feature; MODIFIER	silent_mutation	Average:45.289; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg1216469080	A -> G	LOC_Os12g27930-LOC_Os12g27940	intergenic_region ; MODIFIER	silent_mutation	Average:45.289; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216469080	NA	3.37E-07	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	1.01E-06	4.93E-61	mr1023	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	8.55E-06	6.44E-61	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	7.32E-10	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	9.81E-19	mr1308	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	1.81E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	8.33E-08	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	4.67E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	8.53E-17	mr1401	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	6.43E-09	mr1401	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	2.31E-06	NA	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	7.17E-07	1.12E-62	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	5.51E-06	mr1578	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	4.51E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	2.12E-07	mr1606	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	4.07E-09	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	1.57E-13	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	4.86E-06	NA	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	4.92E-09	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	3.96E-08	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	2.13E-09	mr1942	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	2.46E-09	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	1.22E-06	1.03E-74	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	9.56E-07	1.03E-55	mr1079_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	6.27E-06	NA	mr1178_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	1.37E-12	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	9.92E-10	3.35E-80	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	2.46E-15	mr1489_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	2.85E-08	NA	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216469080	NA	1.09E-13	mr1778_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251