\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216468379:

Variant ID: vg1216468379 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16468379
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGAAAAAAAATCGACTAAAAAGTAAAGGATCACAGCCAGAACTCCCAATTGGCTCCACCATCGTCTGATCATCTCCTCGCCTCCTTCCGAGTTTTCCC[A/G]
GCGCTGCCGTCTCTTCCGCCGCACTTTTAGATCATCACACATCACCGAGATCCCATGGCCATCAGTGAAACTGCAGCTGCCGATGGAAAGACACAAGGAG

Reverse complement sequence

CTCCTTGTGTCTTTCCATCGGCAGCTGCAGTTTCACTGATGGCCATGGGATCTCGGTGATGTGTGATGATCTAAAAGTGCGGCGGAAGAGACGGCAGCGC[T/C]
GGGAAAACTCGGAAGGAGGCGAGGAGATGATCAGACGATGGTGGAGCCAATTGGGAGTTCTGGCTGTGATCCTTTACTTTTTAGTCGATTTTTTTTCATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 20.00% 0.06% 15.57% NA
All Indica  2759 83.50% 2.60% 0.00% 13.88% NA
All Japonica  1512 30.80% 55.80% 0.20% 13.29% NA
Aus  269 65.40% 1.10% 0.00% 33.46% NA
Indica I  595 92.90% 2.70% 0.00% 4.37% NA
Indica II  465 85.80% 4.50% 0.00% 9.68% NA
Indica III  913 77.70% 0.10% 0.00% 22.23% NA
Indica Intermediate  786 81.70% 4.50% 0.00% 13.87% NA
Temperate Japonica  767 3.10% 84.70% 0.26% 11.86% NA
Tropical Japonica  504 78.60% 7.70% 0.20% 13.49% NA
Japonica Intermediate  241 18.70% 63.90% 0.00% 17.43% NA
VI/Aromatic  96 42.70% 2.10% 0.00% 55.21% NA
Intermediate  90 64.40% 25.60% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216468379 A -> DEL N N silent_mutation Average:50.841; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg1216468379 A -> G LOC_Os12g27940.1 upstream_gene_variant ; 740.0bp to feature; MODIFIER silent_mutation Average:50.841; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg1216468379 A -> G LOC_Os12g27930.1 downstream_gene_variant ; 4428.0bp to feature; MODIFIER silent_mutation Average:50.841; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg1216468379 A -> G LOC_Os12g27930-LOC_Os12g27940 intergenic_region ; MODIFIER silent_mutation Average:50.841; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216468379 NA 5.60E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 1.39E-35 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 5.44E-07 3.31E-62 mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 1.37E-35 mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 3.48E-47 mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 4.00E-06 3.35E-62 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 9.39E-06 NA mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 6.17E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 2.71E-19 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 1.59E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 1.58E-07 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 4.66E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 7.87E-18 mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 1.47E-08 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 2.00E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 4.72E-07 4.83E-64 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 1.76E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 4.11E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 9.71E-06 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 1.16E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 9.83E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 5.07E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 1.14E-08 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 1.06E-13 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 1.06E-12 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 1.64E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 1.98E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 1.31E-06 NA mr1922 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 4.68E-08 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 1.34E-73 mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 NA 5.56E-55 mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 6.99E-08 4.84E-78 mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216468379 2.59E-06 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251