\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216465707:

Variant ID: vg1216465707 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16465707
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.02, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAGATAACAATTAAATGTAAATACGAGCACATGGGTTAAGGTTAGGACTTAAAACTGGCTGAGCATATTCCACCACAAAAAATTTCATAAGTTGAGCT[C/A,T]
TACTTCGCTATTTATAACTACACAAAAGACTGCAAGAGCGCAAAGAGATACATATATATCCACTTATGCACATTACACGCACATAAAAGTGTGTATAATA

Reverse complement sequence

TATTATACACACTTTTATGTGCGTGTAATGTGCATAAGTGGATATATATGTATCTCTTTGCGCTCTTGCAGTCTTTTGTGTAGTTATAAATAGCGAAGTA[G/T,A]
AGCTCAACTTATGAAATTTTTTGTGGTGGAATATGCTCAGCCAGTTTTAAGTCCTAACCTTAACCCATGTGCTCGTATTTACATTTAATTGTTATCTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 20.00% 0.53% 14.77% T: 0.11%
All Indica  2759 68.00% 18.30% 0.47% 13.12% T: 0.18%
All Japonica  1512 61.00% 25.70% 0.66% 12.63% NA
Aus  269 66.50% 1.50% 0.00% 31.97% NA
Indica I  595 93.10% 2.70% 0.50% 3.70% NA
Indica II  465 43.00% 47.10% 0.65% 9.25% NA
Indica III  913 68.00% 10.10% 0.44% 21.36% T: 0.11%
Indica Intermediate  786 63.60% 22.50% 0.38% 12.98% T: 0.51%
Temperate Japonica  767 81.60% 6.50% 0.65% 11.21% NA
Tropical Japonica  504 32.90% 53.60% 0.40% 13.10% NA
Japonica Intermediate  241 54.40% 28.20% 1.24% 16.18% NA
VI/Aromatic  96 19.80% 26.00% 1.04% 53.12% NA
Intermediate  90 62.20% 27.80% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216465707 C -> DEL N N silent_mutation Average:42.387; most accessible tissue: Callus, score: 68.777 N N N N
vg1216465707 C -> A LOC_Os12g27940.1 upstream_gene_variant ; 3412.0bp to feature; MODIFIER silent_mutation Average:42.387; most accessible tissue: Callus, score: 68.777 N N N N
vg1216465707 C -> A LOC_Os12g27930.1 downstream_gene_variant ; 1756.0bp to feature; MODIFIER silent_mutation Average:42.387; most accessible tissue: Callus, score: 68.777 N N N N
vg1216465707 C -> A LOC_Os12g27930-LOC_Os12g27940 intergenic_region ; MODIFIER silent_mutation Average:42.387; most accessible tissue: Callus, score: 68.777 N N N N
vg1216465707 C -> T LOC_Os12g27940.1 upstream_gene_variant ; 3412.0bp to feature; MODIFIER silent_mutation Average:42.387; most accessible tissue: Callus, score: 68.777 N N N N
vg1216465707 C -> T LOC_Os12g27930.1 downstream_gene_variant ; 1756.0bp to feature; MODIFIER silent_mutation Average:42.387; most accessible tissue: Callus, score: 68.777 N N N N
vg1216465707 C -> T LOC_Os12g27930-LOC_Os12g27940 intergenic_region ; MODIFIER silent_mutation Average:42.387; most accessible tissue: Callus, score: 68.777 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216465707 5.67E-06 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707 NA 4.89E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707 NA 2.01E-06 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707 9.10E-07 NA mr1142 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707 3.88E-07 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707 8.44E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707 NA 4.53E-07 mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707 NA 1.57E-09 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707 NA 9.15E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707 NA 9.23E-07 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707 NA 4.42E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707 NA 2.91E-11 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707 NA 1.43E-07 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707 NA 9.90E-09 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707 NA 3.44E-10 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707 NA 8.89E-09 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251