Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216465707:

Variant ID: vg1216465707 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16465707
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.02, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAGATAACAATTAAATGTAAATACGAGCACATGGGTTAAGGTTAGGACTTAAAACTGGCTGAGCATATTCCACCACAAAAAATTTCATAAGTTGAGCT[C/A,T]
TACTTCGCTATTTATAACTACACAAAAGACTGCAAGAGCGCAAAGAGATACATATATATCCACTTATGCACATTACACGCACATAAAAGTGTGTATAATA

Reverse complement sequence

TATTATACACACTTTTATGTGCGTGTAATGTGCATAAGTGGATATATATGTATCTCTTTGCGCTCTTGCAGTCTTTTGTGTAGTTATAAATAGCGAAGTA[G/T,A]
AGCTCAACTTATGAAATTTTTTGTGGTGGAATATGCTCAGCCAGTTTTAAGTCCTAACCTTAACCCATGTGCTCGTATTTACATTTAATTGTTATCTTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.60%	20.00%	0.53%	14.77%	T: 0.11%
All Indica	2759	68.00%	18.30%	0.47%	13.12%	T: 0.18%
All Japonica	1512	61.00%	25.70%	0.66%	12.63%	NA
Aus	269	66.50%	1.50%	0.00%	31.97%	NA
Indica I	595	93.10%	2.70%	0.50%	3.70%	NA
Indica II	465	43.00%	47.10%	0.65%	9.25%	NA
Indica III	913	68.00%	10.10%	0.44%	21.36%	T: 0.11%
Indica Intermediate	786	63.60%	22.50%	0.38%	12.98%	T: 0.51%
Temperate Japonica	767	81.60%	6.50%	0.65%	11.21%	NA
Tropical Japonica	504	32.90%	53.60%	0.40%	13.10%	NA
Japonica Intermediate	241	54.40%	28.20%	1.24%	16.18%	NA
VI/Aromatic	96	19.80%	26.00%	1.04%	53.12%	NA
Intermediate	90	62.20%	27.80%	1.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216465707	C -> DEL	N	N	silent_mutation	Average:42.387; most accessible tissue: Callus, score: 68.777	N	N	N	N
vg1216465707	C -> A	LOC_Os12g27940.1	upstream_gene_variant ; 3412.0bp to feature; MODIFIER	silent_mutation	Average:42.387; most accessible tissue: Callus, score: 68.777	N	N	N	N
vg1216465707	C -> A	LOC_Os12g27930.1	downstream_gene_variant ; 1756.0bp to feature; MODIFIER	silent_mutation	Average:42.387; most accessible tissue: Callus, score: 68.777	N	N	N	N
vg1216465707	C -> A	LOC_Os12g27930-LOC_Os12g27940	intergenic_region ; MODIFIER	silent_mutation	Average:42.387; most accessible tissue: Callus, score: 68.777	N	N	N	N
vg1216465707	C -> T	LOC_Os12g27940.1	upstream_gene_variant ; 3412.0bp to feature; MODIFIER	silent_mutation	Average:42.387; most accessible tissue: Callus, score: 68.777	N	N	N	N
vg1216465707	C -> T	LOC_Os12g27930.1	downstream_gene_variant ; 1756.0bp to feature; MODIFIER	silent_mutation	Average:42.387; most accessible tissue: Callus, score: 68.777	N	N	N	N
vg1216465707	C -> T	LOC_Os12g27930-LOC_Os12g27940	intergenic_region ; MODIFIER	silent_mutation	Average:42.387; most accessible tissue: Callus, score: 68.777	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216465707	5.67E-06	NA	mr1023	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707	NA	4.89E-06	mr1042	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707	NA	2.01E-06	mr1043	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707	9.10E-07	NA	mr1142	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707	3.88E-07	NA	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707	8.44E-06	NA	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707	NA	4.53E-07	mr1912	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707	NA	1.57E-09	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707	NA	9.15E-06	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707	NA	9.23E-07	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707	NA	4.42E-06	mr1075_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707	NA	2.91E-11	mr1089_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707	NA	1.43E-07	mr1129_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707	NA	9.90E-09	mr1251_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707	NA	3.44E-10	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216465707	NA	8.89E-09	mr1435_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251