\
| Variant ID: vg1216463200 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16463200 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, G: 0.13, others allele: 0.00, population size: 78. )
TCGTTCGTTGTAATTATTGTGCTCCTCATGGCTGTCCAAGGTAACAATTTATTTCTGCAATTTTTTATGTTGGTAACTACTTCCCTCTCCGTCAAAGGCT[A/G]
CAGTTTTAACCCAAAAATTTGTTCCATGAAGATTGTAATTTTAGAGTGACCTAATTCTTTTCTCTCTAATACTATCTCATCATTTCTTCTCGTTTTAACC
GGTTAAAACGAGAAGAAATGATGAGATAGTATTAGAGAGAAAAGAATTAGGTCACTCTAAAATTACAATCTTCATGGAACAAATTTTTGGGTTAAAACTG[T/C]
AGCCTTTGACGGAGAGGGAAGTAGTTACCAACATAAAAAATTGCAGAAATAAATTGTTACCTTGGACAGCCATGAGGAGCACAATAATTACAACGAACGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.00% | 36.60% | 0.34% | 13.14% | NA |
| All Indica | 2759 | 32.80% | 53.60% | 0.29% | 13.30% | NA |
| All Japonica | 1512 | 79.40% | 11.80% | 0.40% | 8.40% | NA |
| Aus | 269 | 62.80% | 10.80% | 0.37% | 26.02% | NA |
| Indica I | 595 | 21.80% | 73.80% | 0.34% | 4.03% | NA |
| Indica II | 465 | 70.50% | 20.00% | 0.22% | 9.25% | NA |
| Indica III | 913 | 16.00% | 61.90% | 0.11% | 22.02% | NA |
| Indica Intermediate | 786 | 38.40% | 48.50% | 0.51% | 12.60% | NA |
| Temperate Japonica | 767 | 91.10% | 2.10% | 0.52% | 6.26% | NA |
| Tropical Japonica | 504 | 62.70% | 27.60% | 0.20% | 9.52% | NA |
| Japonica Intermediate | 241 | 76.80% | 10.00% | 0.41% | 12.86% | NA |
| VI/Aromatic | 96 | 29.20% | 15.60% | 1.04% | 54.17% | NA |
| Intermediate | 90 | 64.40% | 30.00% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216463200 | A -> DEL | N | N | silent_mutation | Average:62.317; most accessible tissue: Minghui63 young leaf, score: 78.821 | N | N | N | N |
| vg1216463200 | A -> G | LOC_Os12g27920.1 | downstream_gene_variant ; 4812.0bp to feature; MODIFIER | silent_mutation | Average:62.317; most accessible tissue: Minghui63 young leaf, score: 78.821 | N | N | N | N |
| vg1216463200 | A -> G | LOC_Os12g27930.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.317; most accessible tissue: Minghui63 young leaf, score: 78.821 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216463200 | 1.33E-07 | NA | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216463200 | 7.79E-06 | NA | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216463200 | 1.90E-07 | NA | mr1132 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216463200 | 1.83E-07 | NA | mr1132 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216463200 | 3.74E-07 | NA | mr1178 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216463200 | 3.74E-06 | NA | mr1178 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216463200 | 5.77E-08 | NA | mr1390 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216463200 | 2.72E-07 | NA | mr1490 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216463200 | 1.08E-06 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216463200 | 7.42E-06 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216463200 | 5.84E-06 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216463200 | 7.31E-06 | NA | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216463200 | 1.58E-06 | NA | mr1489_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216463200 | NA | 6.72E-06 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |