\
| Variant ID: vg1216456173 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16456173 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, A: 0.36, others allele: 0.00, population size: 80. )
CTTGGCGCTGTTCCTCCGTTTCGTTGTCGGCCATGAATACGCCGAAGAAGAGGGGCGTGTAGTTATCCTCATAGCTGTCGTCGAAGTTGTCGAGGTCGCC[A/G]
TGGTCGTAGTGGTAGCCGAAGTCATCGTAGTCGAGGATCTCGGTTGGTCGAGAACTGACGCCGGGGGAGCTGAGGTAGCCATCCAACTCTTCCGTCGAGA
TCTCGACGGAAGAGTTGGATGGCTACCTCAGCTCCCCCGGCGTCAGTTCTCGACCAACCGAGATCCTCGACTACGATGACTTCGGCTACCACTACGACCA[T/C]
GGCGACCTCGACAACTTCGACGACAGCTATGAGGATAACTACACGCCCCTCTTCTTCGGCGTATTCATGGCCGACAACGAAACGGAGGAACAGCGCCAAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.50% | 12.60% | 13.22% | 38.68% | NA |
| All Indica | 2759 | 31.80% | 2.70% | 16.78% | 48.68% | NA |
| All Japonica | 1512 | 49.90% | 29.80% | 0.40% | 19.91% | NA |
| Aus | 269 | 3.70% | 8.60% | 54.28% | 33.46% | NA |
| Indica I | 595 | 25.40% | 0.30% | 23.19% | 51.09% | NA |
| Indica II | 465 | 63.20% | 9.00% | 7.96% | 19.78% | NA |
| Indica III | 913 | 15.70% | 0.90% | 17.42% | 66.05% | NA |
| Indica Intermediate | 786 | 36.90% | 2.90% | 16.41% | 43.77% | NA |
| Temperate Japonica | 767 | 79.90% | 11.20% | 0.13% | 8.74% | NA |
| Tropical Japonica | 504 | 6.70% | 56.70% | 0.60% | 35.91% | NA |
| Japonica Intermediate | 241 | 44.40% | 32.80% | 0.83% | 21.99% | NA |
| VI/Aromatic | 96 | 3.10% | 24.00% | 5.21% | 67.71% | NA |
| Intermediate | 90 | 36.70% | 25.60% | 5.56% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216456173 | A -> DEL | LOC_Os12g27910.1 | N | frameshift_variant | Average:16.591; most accessible tissue: Minghui63 flag leaf, score: 40.473 | N | N | N | N |
| vg1216456173 | A -> G | LOC_Os12g27910.1 | synonymous_variant ; p.His175His; LOW | synonymous_codon | Average:16.591; most accessible tissue: Minghui63 flag leaf, score: 40.473 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216456173 | NA | 2.82E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216456173 | NA | 4.36E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216456173 | 8.47E-06 | NA | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216456173 | NA | 1.28E-10 | mr1089_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216456173 | NA | 3.65E-06 | mr1112_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216456173 | NA | 5.27E-07 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216456173 | 1.87E-07 | 1.87E-07 | mr1234_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216456173 | NA | 5.47E-08 | mr1257_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216456173 | 4.33E-06 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216456173 | 8.18E-06 | NA | mr1490_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216456173 | 1.48E-06 | NA | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |