\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216456173:

Variant ID: vg1216456173 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16456173
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, A: 0.36, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGGCGCTGTTCCTCCGTTTCGTTGTCGGCCATGAATACGCCGAAGAAGAGGGGCGTGTAGTTATCCTCATAGCTGTCGTCGAAGTTGTCGAGGTCGCC[A/G]
TGGTCGTAGTGGTAGCCGAAGTCATCGTAGTCGAGGATCTCGGTTGGTCGAGAACTGACGCCGGGGGAGCTGAGGTAGCCATCCAACTCTTCCGTCGAGA

Reverse complement sequence

TCTCGACGGAAGAGTTGGATGGCTACCTCAGCTCCCCCGGCGTCAGTTCTCGACCAACCGAGATCCTCGACTACGATGACTTCGGCTACCACTACGACCA[T/C]
GGCGACCTCGACAACTTCGACGACAGCTATGAGGATAACTACACGCCCCTCTTCTTCGGCGTATTCATGGCCGACAACGAAACGGAGGAACAGCGCCAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.50% 12.60% 13.22% 38.68% NA
All Indica  2759 31.80% 2.70% 16.78% 48.68% NA
All Japonica  1512 49.90% 29.80% 0.40% 19.91% NA
Aus  269 3.70% 8.60% 54.28% 33.46% NA
Indica I  595 25.40% 0.30% 23.19% 51.09% NA
Indica II  465 63.20% 9.00% 7.96% 19.78% NA
Indica III  913 15.70% 0.90% 17.42% 66.05% NA
Indica Intermediate  786 36.90% 2.90% 16.41% 43.77% NA
Temperate Japonica  767 79.90% 11.20% 0.13% 8.74% NA
Tropical Japonica  504 6.70% 56.70% 0.60% 35.91% NA
Japonica Intermediate  241 44.40% 32.80% 0.83% 21.99% NA
VI/Aromatic  96 3.10% 24.00% 5.21% 67.71% NA
Intermediate  90 36.70% 25.60% 5.56% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216456173 A -> DEL LOC_Os12g27910.1 N frameshift_variant Average:16.591; most accessible tissue: Minghui63 flag leaf, score: 40.473 N N N N
vg1216456173 A -> G LOC_Os12g27910.1 synonymous_variant ; p.His175His; LOW synonymous_codon Average:16.591; most accessible tissue: Minghui63 flag leaf, score: 40.473 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216456173 NA 2.82E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216456173 NA 4.36E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216456173 8.47E-06 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216456173 NA 1.28E-10 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216456173 NA 3.65E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216456173 NA 5.27E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216456173 1.87E-07 1.87E-07 mr1234_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216456173 NA 5.47E-08 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216456173 4.33E-06 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216456173 8.18E-06 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216456173 1.48E-06 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251