\
| Variant ID: vg1216422805 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16422805 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GACGCGCAGCTGTGGAGGCGAACAAACCAGTCGGCATCAGACAAGGCGGCCAACAATGAAGACGATGACGTCCATCAGTAGTGGTAGCGGTATAAACCAG[C/A]
CGTAGAGGCGAGGGCACTAGTCAGCTGCAGACGAGATGACCGGCGGTGAAGACGATAAGGCCAATCAACACTAGCAGAATCATGCAGCCATGGAAGTGAT
ATCACTTCCATGGCTGCATGATTCTGCTAGTGTTGATTGGCCTTATCGTCTTCACCGCCGGTCATCTCGTCTGCAGCTGACTAGTGCCCTCGCCTCTACG[G/T]
CTGGTTTATACCGCTACCACTACTGATGGACGTCATCGTCTTCATTGTTGGCCGCCTTGTCTGATGCCGACTGGTTTGTTCGCCTCCACAGCTGCGCGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.20% | 0.30% | 6.37% | 56.09% | NA |
| All Indica | 2759 | 16.20% | 0.50% | 6.96% | 76.33% | NA |
| All Japonica | 1512 | 78.00% | 0.10% | 1.26% | 20.70% | NA |
| Aus | 269 | 15.60% | 0.70% | 25.65% | 57.99% | NA |
| Indica I | 595 | 4.70% | 0.50% | 5.88% | 88.91% | NA |
| Indica II | 465 | 35.90% | 0.60% | 7.74% | 55.70% | NA |
| Indica III | 913 | 10.10% | 0.30% | 5.59% | 84.01% | NA |
| Indica Intermediate | 786 | 20.50% | 0.50% | 8.91% | 70.10% | NA |
| Temperate Japonica | 767 | 88.80% | 0.00% | 0.52% | 10.69% | NA |
| Tropical Japonica | 504 | 62.50% | 0.20% | 1.98% | 35.32% | NA |
| Japonica Intermediate | 241 | 75.90% | 0.00% | 2.07% | 21.99% | NA |
| VI/Aromatic | 96 | 34.40% | 0.00% | 14.58% | 51.04% | NA |
| Intermediate | 90 | 62.20% | 0.00% | 7.78% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216422805 | C -> DEL | N | N | silent_mutation | Average:42.117; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| vg1216422805 | C -> A | LOC_Os12g27860.1 | upstream_gene_variant ; 90.0bp to feature; MODIFIER | silent_mutation | Average:42.117; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| vg1216422805 | C -> A | LOC_Os12g27850-LOC_Os12g27860 | intergenic_region ; MODIFIER | silent_mutation | Average:42.117; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216422805 | 2.46E-06 | 2.46E-06 | mr1048_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422805 | NA | 1.19E-06 | mr1057_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422805 | NA | 1.02E-06 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422805 | NA | 8.68E-08 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422805 | 9.10E-06 | NA | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422805 | 2.68E-06 | NA | mr1258_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422805 | NA | 3.86E-06 | mr1570_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216422805 | NA | 4.85E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |