Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216414409:

Variant ID: vg1216414409 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16414409
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.59, A: 0.41, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTTATCCCAAAATAAATAAATTTAAAATAGGATATAATATTTTATAGAACAGCGAACGTAGAAATATCTCTGTATAGATCCGTTATATTAGAAAAAAT[A/G]
CGACATCTGATTTTTAGATTGGTTTATTCTAAGACGGAAGAAGTACAGGCCTATGTGCCCCTGTCATAGAAAAAACAAATTTCTGGTTATTCCATATTTG

Reverse complement sequence

CAAATATGGAATAACCAGAAATTTGTTTTTTCTATGACAGGGGCACATAGGCCTGTACTTCTTCCGTCTTAGAATAAACCAATCTAAAAATCAGATGTCG[T/C]
ATTTTTTCTAATATAACGGATCTATACAGAGATATTTCTACGTTCGCTGTTCTATAAAATATTATATCCTATTTTAAATTTATTTATTTTGGGATAAAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.90% 42.00% 0.13% 0.00% NA
All Indica  2759 66.20% 33.60% 0.14% 0.00% NA
All Japonica  1512 35.10% 64.90% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 79.20% 20.80% 0.00% 0.00% NA
Indica II  465 31.00% 68.80% 0.22% 0.00% NA
Indica III  913 77.20% 22.60% 0.22% 0.00% NA
Indica Intermediate  786 64.50% 35.40% 0.13% 0.00% NA
Temperate Japonica  767 22.80% 77.10% 0.13% 0.00% NA
Tropical Japonica  504 45.80% 54.20% 0.00% 0.00% NA
Japonica Intermediate  241 51.50% 48.50% 0.00% 0.00% NA
VI/Aromatic  96 74.00% 26.00% 0.00% 0.00% NA
Intermediate  90 47.80% 51.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216414409 A -> G LOC_Os12g27850.1 downstream_gene_variant ; 799.0bp to feature; MODIFIER silent_mutation Average:48.179; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N
vg1216414409 A -> G LOC_Os12g27850-LOC_Os12g27860 intergenic_region ; MODIFIER silent_mutation Average:48.179; most accessible tissue: Zhenshan97 flower, score: 71.992 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216414409 4.69E-06 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 5.48E-06 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 8.34E-07 NA mr1079 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 NA 9.58E-06 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 9.24E-06 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 3.69E-07 NA mr1142 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 6.66E-07 NA mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 NA 4.24E-06 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 NA 4.69E-06 mr1219 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 1.94E-07 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 9.13E-06 NA mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 1.07E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 NA 2.79E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 1.35E-06 NA mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 7.97E-07 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 3.04E-07 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 4.18E-09 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 4.28E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 NA 1.42E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 NA 1.15E-06 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 4.98E-07 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 6.21E-09 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 5.50E-07 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216414409 NA 1.78E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251