Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216411230:

Variant ID: vg1216411230 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16411230
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TTGAGGAGAAGGGGATTGAGGAGGTTGGAAAGATACGCAAAACGAGGTGAGCTATTAGCTCATGATTAATTGAGTATTAACTATTTTAAATTTTAAAAAT[G/A]
GATTAATATGATTTTTTAAAGCAACTTTCATATAGAAAATTTTTGCAAAAAACACACCGTTTAGTAGTTTGGGAAACGTGCACGCGGAAAACGAAACAAA

Reverse complement sequence

TTTGTTTCGTTTTCCGCGTGCACGTTTCCCAAACTACTAAACGGTGTGTTTTTTGCAAAAATTTTCTATATGAAAGTTGCTTTAAAAAATCATATTAATC[C/T]
ATTTTTAAAATTTAAAATAGTTAATACTCAATTAATCATGAGCTAATAGCTCACCTCGTTTTGCGTATCTTTCCAACCTCCTCAATCCCCTTCTCCTCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	22.10%	5.50%	3.26%	69.17%	NA
All Indica	2759	3.80%	0.50%	1.09%	94.67%	NA
All Japonica	1512	58.80%	15.70%	0.13%	25.33%	NA
Aus	269	8.90%	0.40%	37.55%	53.16%	NA
Indica I	595	2.40%	0.20%	0.17%	97.31%	NA
Indica II	465	3.90%	0.20%	0.43%	95.48%	NA
Indica III	913	3.40%	0.80%	1.42%	94.41%	NA
Indica Intermediate	786	5.20%	0.50%	1.78%	92.49%	NA
Temperate Japonica	767	88.00%	8.00%	0.13%	3.91%	NA
Tropical Japonica	504	10.90%	27.60%	0.00%	61.51%	NA
Japonica Intermediate	241	66.00%	15.80%	0.41%	17.84%	NA
VI/Aromatic	96	0.00%	3.10%	14.58%	82.29%	NA
Intermediate	90	30.00%	4.40%	7.78%	57.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216411230	G -> DEL	N	N	silent_mutation	Average:26.65; most accessible tissue: Callus, score: 43.204	N	N	N	N
vg1216411230	G -> A	LOC_Os12g27850.1	upstream_gene_variant ; 1465.0bp to feature; MODIFIER	silent_mutation	Average:26.65; most accessible tissue: Callus, score: 43.204	N	N	N	N
vg1216411230	G -> A	LOC_Os12g27840.1	downstream_gene_variant ; 4577.0bp to feature; MODIFIER	silent_mutation	Average:26.65; most accessible tissue: Callus, score: 43.204	N	N	N	N
vg1216411230	G -> A	LOC_Os12g27840-LOC_Os12g27850	intergenic_region ; MODIFIER	silent_mutation	Average:26.65; most accessible tissue: Callus, score: 43.204	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216411230	3.08E-08	NA	mr1023	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216411230	3.45E-06	NA	mr1079	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216411230	2.76E-07	NA	mr1142	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216411230	NA	7.96E-06	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216411230	4.23E-09	NA	mr1489	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216411230	6.00E-07	NA	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216411230	1.92E-07	NA	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216411230	4.53E-08	NA	mr1023_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216411230	2.38E-10	NA	mr1489_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216411230	4.68E-07	NA	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251