| Variant ID: vg1216409177 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16409177 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGTCAAATTTTATTCAAAATTCATGAAAGTTTCAAAAAATTTCAGCAAAAAAGTACTGAAATTTTCGAAATTTCGGTTCTGTCGGCCATGTCGGCCACCC[C/T]
TGGCAAAAATCACAATTTCAAGATTGCTAACCCTGATCTTGAATCCAATGATACACAATGGATTGCATGATTATACTGGAATGGAGGGTTTGCGCCTAAT
ATTAGGCGCAAACCCTCCATTCCAGTATAATCATGCAATCCATTGTGTATCATTGGATTCAAGATCAGGGTTAGCAATCTTGAAATTGTGATTTTTGCCA[G/A]
GGGTGGCCGACATGGCCGACAGAACCGAAATTTCGAAAATTTCAGTACTTTTTTGCTGAAATTTTTTGAAACTTTCATGAATTTTGAATAAAATTTGACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 0.40% | 2.60% | 5.50% | NA |
| All Indica | 2759 | 97.20% | 0.70% | 0.91% | 1.23% | NA |
| All Japonica | 1512 | 95.80% | 0.10% | 0.86% | 3.24% | NA |
| Aus | 269 | 22.30% | 0.00% | 15.24% | 62.45% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 0.90% | 1.08% | 1.29% | NA |
| Indica III | 913 | 97.90% | 0.40% | 0.77% | 0.88% | NA |
| Indica Intermediate | 786 | 94.40% | 1.40% | 1.65% | 2.54% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 88.90% | 0.20% | 1.79% | 9.13% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.40% | 1.24% | 1.24% | NA |
| VI/Aromatic | 96 | 56.20% | 0.00% | 40.62% | 3.12% | NA |
| Intermediate | 90 | 87.80% | 0.00% | 5.56% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216409177 | C -> DEL | N | N | silent_mutation | Average:27.424; most accessible tissue: Callus, score: 64.298 | N | N | N | N |
| vg1216409177 | C -> T | LOC_Os12g27850.1 | upstream_gene_variant ; 3518.0bp to feature; MODIFIER | silent_mutation | Average:27.424; most accessible tissue: Callus, score: 64.298 | N | N | N | N |
| vg1216409177 | C -> T | LOC_Os12g27840.1 | downstream_gene_variant ; 2524.0bp to feature; MODIFIER | silent_mutation | Average:27.424; most accessible tissue: Callus, score: 64.298 | N | N | N | N |
| vg1216409177 | C -> T | LOC_Os12g27840-LOC_Os12g27850 | intergenic_region ; MODIFIER | silent_mutation | Average:27.424; most accessible tissue: Callus, score: 64.298 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216409177 | NA | 4.83E-55 | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1216409177 | NA | 1.29E-12 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1216409177 | NA | 7.37E-49 | mr1016 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216409177 | NA | 8.06E-42 | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216409177 | NA | 2.00E-31 | mr1022 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216409177 | NA | 2.59E-65 | mr1023 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216409177 | NA | 2.47E-40 | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216409177 | NA | 6.56E-52 | mr1079 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216409177 | NA | 8.40E-42 | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216409177 | NA | 1.69E-10 | mr1089 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/