Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1216368951:

Variant ID: vg1216368951 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16368951
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


GCTACTTCATCCTCGCCGTCGACGTCTCCATCCGACGCGACGGCGAGACCGGAACAACAGCGGCGGCGACGATCATGCTGTTGCCTACCGAACTCCGTGC[C/G]
CCGTCGTACACCGGCGAGGCAACCGTCACGCCGACGGCGGGGCAGCTCCTGCTTTCGCCGTCGTCGTGCGGCGGCGGCAGAAGGTCGTCGTTGGCGCTGC

Reverse complement sequence

GCAGCGCCAACGACGACCTTCTGCCGCCGCCGCACGACGACGGCGAAAGCAGGAGCTGCCCCGCCGTCGGCGTGACGGTTGCCTCGCCGGTGTACGACGG[G/C]
GCACGGAGTTCGGTAGGCAACAGCATGATCGTCGCCGCCGCTGTTGTTCCGGTCTCGCCGTCGCGTCGGATGGAGACGTCGACGGCGAGGATGAAGTAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.20% 6.50% 1.04% 13.25% NA
All Indica  2759 75.50% 1.70% 1.34% 21.46% NA
All Japonica  1512 82.70% 15.10% 0.73% 1.39% NA
Aus  269 98.90% 0.40% 0.00% 0.74% NA
Indica I  595 93.40% 0.00% 0.00% 6.55% NA
Indica II  465 84.50% 7.50% 1.51% 6.45% NA
Indica III  913 56.40% 0.10% 2.19% 41.29% NA
Indica Intermediate  786 78.90% 1.30% 1.27% 18.58% NA
Temperate Japonica  767 99.60% 0.10% 0.00% 0.26% NA
Tropical Japonica  504 52.00% 42.30% 2.18% 3.57% NA
Japonica Intermediate  241 93.40% 6.20% 0.00% 0.41% NA
VI/Aromatic  96 76.00% 21.90% 0.00% 2.08% NA
Intermediate  90 77.80% 11.10% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216368951 C -> DEL LOC_Os12g27760.1 N frameshift_variant Average:65.85; most accessible tissue: Zhenshan97 root, score: 83.087 N N N N
vg1216368951 C -> G LOC_Os12g27760.1 synonymous_variant ; p.Ala339Ala; LOW synonymous_codon Average:65.85; most accessible tissue: Zhenshan97 root, score: 83.087 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1216368951 C G -0.05 -0.03 -0.04 -0.03 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216368951 NA 3.03E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216368951 NA 9.43E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216368951 NA 2.35E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216368951 NA 4.87E-09 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216368951 NA 3.82E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216368951 NA 5.33E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216368951 1.14E-06 NA mr1133_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216368951 NA 9.62E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216368951 NA 4.10E-06 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216368951 NA 7.87E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216368951 NA 7.91E-10 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216368951 NA 5.79E-06 mr1782_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216368951 NA 5.66E-09 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216368951 NA 3.60E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216368951 NA 7.23E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251